Skip to main content

Table 1 Gene names, gene accession numbers and primers used in this study

From: The stability of the coiled-coil structure near to N-terminus influence the heat resistance of harpin proteins from Xanthomonas

Name Accession number   Primer sequence (5′-3′) PCR product size (bp) Purpose
hpaXm DQ643828.1 Forward CGGGATCCATGAATTCTTTGAACACACAG (BamHI)a 428 PCR for cloning
Reverse AAGGAAAAAAGCGGCCGCTTACTGCATCGATCCGGTGTCGCT (NotI)a
hpa1Xoo CP000967.2 Forward CGGGATCCATGAATTCTTTGAACACACAA (BamHI)a 446 PCR for cloning
Reverse AAGGAAAAAAGCGGCCGCTTACTGCATCGATGCGCTGTCGCT (NotI)a
hpaXpm KY765410.1 Forward CGGGATCCATGAACCCAGCGGCGCAGACC (BamHI)a 435 PCR for cloning
Reverse CCGCTCGAGTTACTGCATCGATCCGGTGTCGCT (XhoI)a
hpaXcm KY697778.1 Forward CGGGATCCATGATGAATTCTTTGAACACA (BamHI)a 422 PCR for cloning
Reverse CCGCTCGAGTTACTGCATCGATCCGGTGTCGCT (XhoI)a
  1. aThe underlined sequences are restriction site BamHI, NotI or XhoI