Skip to main content

Table 1 Primers and probes used in this study

From: Development and comparative validation of genomic-driven PCR-based assays to detect Xanthomonas citri pv. citri in citrus plants

Primers/probes Sequence 5′ > 3’ Amplicon size
XAC1051-2qPCR
 P-XAC1051-MGB (6-Fam™) CGGTGAGAAGCTGTAC 58 bp
 qPCR-XAC1051-F AGAGGCGCACTATGGCTTTC
 qPCR-XAC1051-R CAACCCAGGACCTGCAAGAA
 P-citrus5.8S- MGB (Vic™) ATCCCGTGAACCATCG 94 bp
 citrus5.8S -F GCGAAATGCGATACTTGGTGTGA
 citrus5.8S-R CGTGCCCTCGGCCTAATG
XAC1051-F/R PCR
 XAC1051-F AAATTCTTGTCGATCTGCTGGCT 499 bp
 XAC1051-R GCCGCCGCATAATTCTTCTCAC