Skip to main content

Table 1 Oligonucleotide used as primer for amplification

From: Detection of clinically important non tuberculous mycobacteria (NTM) from pulmonary samples through one-step multiplex PCR assay

S. No. Target Gene Target Organism Primer Sequences Product Size (bp) Reference
1 16S rRNA Mycobacterium
Species
TGAGATACGGCCCAGACTCCT
CTCTAGACGCGTCCTGTGCAT
688 This study
2 ITS region MAC CAACAGCAAATGATTGCCAG
CACATTTCGATGAACGCCG
169 This study
3 ITS region MK ATCCCAACAAGTGGGGTGC
CGCTACCCGTAGGGCAACG
218 This study
4 16S rRNA MA CCTTTCTAAGGAGCACCATTT
CGAGCGAGGCTATGTTTAGAT
271 This study