Skip to main content

Table 5 Primer pairs that were used in the amplification of the aflatoxin biosynthesis gene [40]

From: Genetic diversity of aflatoxin-producing Aspergillus flavus isolated from selected groundnut growing agro-ecological zones of Uganda

Marker Forward 5′ → 3’ Reverse 5′ → 3’ Amplicon size (bp)
AFLC01 CCGACCTCACGACGCATTAT CCGGCTAGCTTCAACAGACG 140–370
AFLC02 GGTTGGCGGATTGAGAGGTA GGAGATCAGCCGAGAAGACA 100–296
AFLC03 TCCGCCGAGAGCCATAATAG GGATGCTGACACCTCGATAG 120–160
AFLC07 GTCAGCAAGAGGAGCCTTCA GGTCACGGAGATCCTCCATA 159–404
AFLC08 CGCCAGCACGGAGATCGAAT CGTCTCCTCAGGCGGTCTAT 224–399
AFLC12 CGCAAGGAGCTCGACCAATA TTCAGCTCAGCGACGAGAGT 241–360
AFLC13 TCGGTTCAATGCTCGAACAC TCCAACCTTCGGCCTAGTCT 140–410
AFLC15 GCTCTACAGGCTGATTCAAG TCGACAGTCCGACAATATGC 204–370
AFLC16 ATCGCAGCGGAAGCTTGGAA AGTCTCGGACTCCGGTGACA 145–410
AFLC17 GCACAACTCGTACAGCTATC TCTAAGTGCGAGGCAACGAA 125–390
AFLC18 GGCAGCCAGACCAAGGAATA CCTTCTCGTAGCCGCTCATC 130–400
AFLC19 ACAGGACCGCACGGATCAAT AGGAGCGGATGTCGAAGTCT 260–491
AFLC20 GCCTAGCGCTCCATTCTCAG CCATCGTATCCGGCTCTATC 120–370
AFLC21 TACCTTACTCCGCTAAGCAG GCGGTCACCTACCAATGAAT 150–368
AFLC22 TTCGCAGGAGTGTAGCCAAG GTTGGAACACGCTCCATAGG 120–371
AFLC24 GAACGAGATAACGGCTGCAT ATCAATCCACGGACCGTTGT 100–430