Skip to main content

Table 1 Primers used in this work

From: Pseudonajide peptide derived from snake venom alters cell envelope integrity interfering on biofilm formation in Staphylococcus epidermidis

Gene Forward primer 5'-3' Reverse primer 5'-3' Amplicon
atlE TACCAGGGTTTGCAGGATTC GGCGCTAAATTCATTGGAAA 85 bp
aap AGGCCGTACCAACAGTGAAT ATGGGCAAACGTAGACAAGG 100 bp
agrC TCATCAATATCGCATTCATCG CCTAAACCGCGATTATCACC 136 bp
icaA TTATCAATGCCGCAGTTGTC CCGTTGGATATTGCCTCTGT 104 bp
leuA GATGATCTCGGAATGGCAGT TGAGGCATTTCCTGCTCTTT 108 bp
saeR GCTAACACTGTCAATGTCCACA AGGCCCCACACAGTTGTAAT 92 bp
saeS GGCGTCAATTTGTTGTGCTA AGGGCATAGGTATCGTTCCA 140 bp
sarA TTTGCTTCTGTGATACGGTTGT CGTAATGAACACGATGAAAGAACT 107 bp
ugtP (45) AAGCTGGTGTTCCTGCTTC ATGACCACTTGCGAATTTGG 216 bp
ltaA (45) GCCTTGGTTGTGCTTATTGC GGAAGAATAGGTACAAGTGC 184 bp
ltaS (45) ATGGTAAAGAGGTTACACC CCTTCAGTGAATAGGCTGAG 172 bp
qPCR16sRNA(45) AGGAGTCTGGACCGTGTCTC GCGTAGCCGACCTGAGAG 51 bp