Skip to main content

Table 3 Primers used in qRT-PCR

From: Essential role of Salmonella Enteritidis DNA adenine methylase in modulating inflammasome activation

Primer name Primer sequence (5′ to 3′) Target
c-Fos-F CTCCCGTGGTCACCTGTACT Detection of mRNA
c-Fos-R TTGCCTTCTCTGACTGCTCA Detection of mRNA
Braf-F GTAGCGCCTGTTCAGTCCTC Detection of mRNA
Braf-R GAGCAGCCTGAGTGGTTAGG Detection of mRNA
Rasa1-F CGGGGTCCTTTGTACTTTCA Detection of mRNA
Rasa1-R TGGTGGTGCAACTGGATAGA Detection of mRNA
Sos2-F CAGTCCTCTTGCCACACTCA Detection of mRNA
Sos2-R GTGGAATAGCAGGAGGGTCA Detection of mRNA
Nr4a1-F CTTGAGTTCGGCAAGCCTAC Detection of mRNA
Nr4a1-R CGAGGATGAGGAAGAAGACG Detection of mRNA
Elk4-F AGCTTTGCCAGAAAAGGACA Detection of mRNA
Elk4-R TGGTGTAAGAGACGCTGTCG Detection of mRNA
Mef2c-F ACGCCTGTCACCTAACATCC Detection of mRNA
Mef2c-R AGCTCTCAAACGCCACACTT Detection of mRNA
Cul1-F GAATTGGGGCTGAATGAAGA Detection of mRNA
Cul1-R AACTCTCCGCTGTTCCTCAA Detection of mRNA
Tgfbr1-F GGCGAAGGCATTACAGTGTT Detection of mRNA
Tgfbr1-R TGCACATACAAATGGCCTGT Detection of mRNA
Rps6kb1-F GCTGTGGATTGGTGGAGTTT Detection of mRNA
Rps6kb1-R GCTTGGACTTCTCCAGCATC Detection of mRNA
Sp1-F TGCAGCAGAATTGAGTCACC Detection of mRNA
Sp1-R CACAACATACTGCCCACCAG Detection of mRNA
Rbl1-F AAACCTTGCACCACAAGTACG Detection of mRNA
Rbl1-R GCACAGGAGACATTTGATCATT Detection of mRNA
Id1-F CCAGTGGGTAGAGGGTTTGA Detection of mRNA
Id1-R AGAAATCCGAGAAGCACGAA Detection of mRNA
Id3-F ACTCAGCTTAGCCAGGTGGA Detection of mRNA
Id3-R GTCAGTGGCAAAAGCTCCTC Detection of mRNA
Xiap-F TTGGAACATGGACATCCTCA Detection of mRNA
Xiap-R TGCCCCTTCTCATCCAATAG Detection of mRNA
Bcl3-F TTACTCTACCCCGACGATGG Detection of mRNA
Bcl3-R CCAAGCTTGAAAAGGCTGAG Detection of mRNA
Chuk-F TGGAGCCTACGAAGCTGTTT Detection of mRNA
Chuk-R CCCTCATTAGTTGCGGTGTT Detection of mRNA
Dnm1l-F ACCCGGAGACCTCTCATTCT Detection of mRNA
Dnm1l-R GGCGAGAAAACCTTGAGATG Detection of mRNA
Akt3-F GAAACTGGCCACTTCTGCTC Detection of mRNA
Akt3-R ACTGAGGTGTGGTGGAGACC Detection of mRNA
Itch-F CATGTGGTTTTGGCAGTTTG Detection of mRNA
Itch-R TTGTAAGGTGGGAGGTCCAG Detection of mRNA
Pik3ca-F ACTGTTCAGAGAGGCCAGGA Detection of mRNA
Pik3ca-R CGGTTGCCTACTGGTTCAAT Detection of mRNA
Pik3r1-F GCGTGACATGTAGGCTCTCA Detection of mRNA
Pik3r1-R CAGTTTCCTTGGCTTTGCTC Detection of mRNA
Pten-F CATAACGATGGCTGTGGTTG Detection of mRNA
Pten-R CGGGGTAAGGCTGTTTTACA Detection of mRNA
Irs2-F GTAGTTCAGGTCGCCTCTGC Detection of mRNA
Irs2-R CAGCTATTGGGACCACCACT Detection of mRNA
Sirt1-F AGTTCCAGCCGTCTCTGTGT Detection of mRNA
Sirt1-R CTCCACGAACAGCTTCACAA Detection of mRNA
Klf2-F GCCTGTGGGTTCGCTATAAA Detection of mRNA
Klf2-R AAGGAATGGTCAGCCACATC Detection of mRNA
Sgk3-F ATCCAGATGTCCGAGCATTC Detection of mRNA
Sgk3-R GAAGAACCTTGCCAAAGCTG Detection of mRNA
Pdpk1-F GGTCCAGTGGATAAGCGAAA Detection of mRNA
Pdpk1-R TTTCTGCACCACTTGTGAGC Detection of mRNA
Mdm2-F TGCAAGCACCTCACAGATTC Detection of mRNA
Mdm2-R ACACAATGTGCTGCTGCTTC Detection of mRNA
\