Skip to main content

Table 2 Primers used in this study

From: Essential role of Salmonella Enteritidis DNA adenine methylase in modulating inflammasome activation

Primer name Primer sequence (5′ to 3′) Target
AB1 GGCCACGCGTCGACTAGTACNNNNNNNNNNACGCC For transposon insertion sequencing
AB2 GGCCACGCGTCGACTAGTACNNNNNNNNNNCCTGG For transposon insertion sequencing
AB3 GGCCACGCGTCGACTAGTACNNNNNNNNNNCCTCG For transposon insertion sequencing
ABS GGCCACGCGTCGACTAGTAC For transposon insertion sequencing
SP1 GCTGACCGCTTCCTCGTGCTTTACG For transposon insertion sequencing
SP2 CATCGCCTTCTATCGCCTTCTTGAC For transposon insertion sequencing
pSC189-seq CGCGAAGTTCCTATTCCGAAGTTCC For transposon insertion sequencing
pDM4-F GGTGCTCCAGTGGCTTCTGTTTCTA For deletion mutants
pDM4-R CAGCAACTTAAATAGCCTCTAAT For deletion mutants
dam-up-F GAGCGGATAACAATTTGTGGAATCCCGGGAGACGCCGAAAGCGACCACCACGACG For dam deletion mutant
dam-up-R TTGAGAATTACATGCTGACTAACTAATTACACCTT For dam deletion mutant
dam-down-F AGTCAGCATGTAATTCTCAAGGAGAAGCGGATGAA For dam deletion mutant
dam-down-R AGCGGAGTGTATATCAAGCTTATCGATACCCGATCTCGCCGATATTGTTCACCTT For dam deletion mutant
dam-in-F CGAGTGCCTTGTCGAACCTTTTGTG For dam deletion mutant
dam-in-R ACAGAGCCAGCAGTTCGTCCACCTT For dam deletion mutant
dam-out-F AACCACGACTGCGGAACCGAAGAAA For dam deletion mutant
dam-out-R TCGGGTTTATCGAAAATTGCCGACC For dam deletion mutant
invC-up-F GAGCGGATAACAATTTGTGGAATCCCGGGAGTCCTCCTTACGTCTGTCGATGTCC For invC deletion mutant
invC-up-R GCGAATGCATTCATCTCATTAGCGACCGACTAAAA For invC deletion mutant
invC-down-F AATGAGATGAATGCATTCGCTGACCAGAATTAAAG For invC deletion mutant
invC-down-R AGCGGAGTGTATATCAAGCTTATCGATACCAATGCTTCTGATAAACCGCCAACCT For invC deletion mutant
invC-in-F GGGAACGCACCGTGTTGAGCCTTAT For invC deletion mutant
invC-in-R CCAGGACGATATTCTCCCAAGTCAA For invC deletion mutant
invC-out-F CAGTACCTTCCTCAGCCTTGACCCG For invC deletion mutant
invC-out-R GCATTACGAAAGCATCGCCATAGTC For invC deletion mutant
hilD-up-F GAGCGGATAACAATTTGTGGAATCCCGGGAGCTCATGGAGTATAATTTCGGTCGT For hilD deletion mutant
hilD-up-R AAAAATGTTACATATTATCCCTTTGTTGATGTTAT For hilD deletion mutant
hilD-down-F GGATAATATGTAACATTTTTTGTATCTGTCACTTA For hilD deletion mutant
hilD-down-R AGCGGAGTGTATATCAAGCTTATCGATACCTGAAAGACTGTTTTTAATGGTGCGC For hilD deletion mutant
hilD-in-F GTCAGACTCAGCAGGTTACCATCAA For hilD deletion mutant
hilD-in-R CATTATGGTTGCCTATGCGTAAAAG For hilD deletion mutant
hilD-out-F TTCACCGACCTGTATTGGCGTATTT For hilD deletion mutant
hilD-out-R TTTTGGGGTGTAAATGCTGCTTATT For hilD deletion mutant
prgH-up-F GAGCGGATAACAATTTGTGGAATCCCGGGACACCAACATCCCAGGTTCGTCACAG For prgH deletion mutant
prgH-up-R CGTTAAATTACATATATACTGTTAGCGATGTCTGT For prgH deletion mutant
prgH-down-F AGTATATATGTAATTTAACGTAAATAAGGAAGTCA For prgH deletion mutant
prgH-down-R AGCGGAGTGTATATCAAGCTTATCGATACCTTCAACAGCCCCGACTCCTTTACGA For prgH deletion mutant
prgH-in-F GTTTGCTGCTCGTTTGGGATAAGTG For prgH deletion mutant
prgH-in-R GGCAAGGGTCATTACCAGCAGAAAG For prgH deletion mutant
prgH-out-F GAACGGCTGTGAGTTTCCATTGCTG For prgH deletion mutant
prgH-out-R GACGGGCTCTGAGTATTTCTACATC For prgH deletion mutant
spaN-up-F GAGCGGATAACAATTTGTGGAATCCCGGGAATTGACTTGGGAGAATATCGTCCTG For spaN deletion mutant
spaN-up-R AATGACATCACATTAAATTATCTCCTCTGACTCGG For spaN deletion mutant
spaN-down-F TAATTTAATGTGATGTCATTGCGTGTGAGACAGAT For spaN deletion mutant
spaN-down-R AGCGGAGTGTATATCAAGCTTATCGATACCCGCACGGGAAGTACGAATCAGGAGT For spaN deletion mutant
spaN-in-F CGACTATGGCGATGCTTTCGTAATG For spaN deletion mutant
spaN-in-R CAAACGATGTTCAACCTGCGTATTT For spaN deletion mutant
spaN-out-F AAAGCGTAAGCCGCGTTTTTGGACA For spaN deletion mutant
spaN-out-R CAATTGATTCAAGCCAGGCAGAGTT For spaN deletion mutant
pMMB207-F CTCCCGTTCTGGATAATGTT For complemented mutants
pMMB207-R GGCGTTTCACTTCTGAGTTCG For complemented mutants
pMMB207-dam-F AGCTCGGTACCCGGGGATCCTCTAGCTAAAGGAAGACGTTATGAAAAAAAATCGCGCTTTTTTGA For complemented mutant of ∆dam
pMMB207-dam-R TCTCATCCGCCAAAACAGCCAAGCTTTATTTTCTTGCAGGCGTTGCGACT For complemented mutant of ∆dam
pMMB207-invC-F AGCTCGGTACCCGGGGATCCTCTAGCTAAAGGAAGACGTTATGAAAACACCTCGTTTACTGCAAT For complemented mutant of ∆ invC
pMMB207-invC-R TCTCATCCGCCAAAACAGCCAAGCTTTAATTCTGGTCAGCGAATGCATTC For complemented mutant of ∆ invC
pMMB207-prgH-F AGCTCGGTACCCGGGGATCCTCTAGCTAAAGGAAGACGTTATGGAAACATCAAAAGAGAAGACGA For complemented mutant of ∆prgH
pMMB207-prgH-R TCTCATCCGCCAAAACAGCCAAGCTTTAAAGTGGGCTTGGGAAATACCAA For complemented mutant of ∆prgH
pMMB207-spaN-F AGCTCGGTACCCGGGGATCCTCTAGCTAAAGGAAGACGTTATGGGCGATGTGTCAGCTGTCAGTT For complemented mutant of ∆spaN
pMMB207-spaN-R TCTCATCCGCCAAAACAGCCAAGCTTCAGGCGTCATCCTCCTCGCCAGAT For complemented mutant of ∆spaN
pCX340-F AGACAATCTGTGTGGGCACTCGACC For β-lactamase TEM-1 fusion plasmid
pCX340-R TTCTGAGAATAGTGTATGCGGCGAC For β-lactamase TEM-1 fusion plasmid
pCX340-dam-F AAGGAGGAATAACATATGATGAAAAAAAATCGCGCTTTTTTGA For β-lactamase TEM-1 fusion plasmid
pCX340-dam-R GTGCGAATTCTCCGCGGAGGTACCTTTTCTTGCAGGCGTTGCGACT For β-lactamase TEM-1 fusion plasmid
pCX340-invC-F AAGGAGGAATAACATATGATGAAAACACCTCGTTTACTGCAAT For β-lactamase TEM-1 fusion plasmid
pCX340-invC-R GTGCGAATTCTCCGCGGAGGTACCATTCTGGTCAGCGAATGCATTC For β-lactamase TEM-1 fusion plasmid
pCX340-prgH-F AAGGAGGAATAACATATGATGGAAACATCAAAAGAGAAGACGA For β-lactamase TEM-1 fusion plasmid
pCX340-prgH-R GTGCGAATTCTCCGCGGAGGTACCAAGTGGGCTTGGGAAATACCAA For β-lactamase TEM-1 fusion plasmid
pCX340-spaN-F AAGGAGGAATAACATATGATGGGCGATGTGTCAGCTGTCAGTT For β-lactamase TEM-1 fusion plasmid
pCX340-spaN-R GTGCGAATTCTCCGCGGAGGTACCGGCGTCATCCTCCTCGCCAGAT For β-lactamase TEM-1 fusion plasmid
\