Skip to main content

Table 1 Primers and TaqMan probes used for qPCR analysis, amplification efficiency and sensitivity analysis

From: Screening and identification of BP100 peptide conjugates active against Xylella fastidiosa using a viability-qPCR method

qPCR assay Primer/ probe Sequence Amplicon length (bp) Slope R2 Efficiency (%) Sensitivitya Reference of source
HL-1 rev-2 GGTTTTGCTGACTGGCAACA 221 −3.47 0.99 94 30.8 37
HL-2 rev-3 CACTTGTGGTAAGCATCCTGAG 307 −3.49 0.99 94 31.8 This study
for AAGGCAATAAACGCGCACTA       37
probe FAM/−TGGCAGGCAGCAACGATACGGCT−/BHQ       37
XF16S-1 rev-1 CCGATGTATTCCTCACCCGTC 62 −3.39 0.99 97 27.2 39
XF16S-2 rev-2 CTAATCGGACATCGGCTCAT 181 −3.39 0.99 97 28.1 This study
XF16S-3 rev-3 GTAGGAGTCTGGACCGTGTCTC 279 −3.39 0.99 97 29.7 21
  for CGGCAGCACGTTGGTAGTAA       39
  probe FAM/−CATGGGTGGCGAGTGGC−/TAMRA       39
EFTu-1 rev-1 GGCGAGCCAACAAAATGTGTT 77 −3.21 0.99 95 28.4 38
EFTu-2 rev-2 ATCACCAGGAAAATCATACTTGCT 202 −3.38 0.99 98 29.4 This study
EFTu-3 rev-3 GAATGTGGGTATCCAATGCTTC 311 −3.21 0.99 95 33.9 This study
for GGATGGTGCGATTTTAGTATGTTCT       38
probe FAM/−TGATGGTCCGATGCCTCAGACTCGT−/TAMRA       38
  1. aCT value at a concentration of 5 × 103 CFU/ml