Skip to main content

Table 4 Primer nucleotide sequences used for qRT-PCR assay

From: Differences in the gut Firmicutes to Bacteroidetes ratio across age groups in healthy Ukrainian population

Phylum Primer nucleotide sequence
Forward Reverse
Actinobacteria Act920F3 TACGGCCGCAAGGCTA Act1200R TCRTCCCCACCTTCCTCCG
Firmicutes 928F-firm TGAAACTYAAGGAATTGACG 1040FirmR ACCATGCACCACCTGTC
Bacteroidetes 798cfbF CRAACAGGATTAGATACCCT cfb967R GGTAAGGTTCCTCGCGCTAT
16S rRNA gene 926F AAACTCAAAKGAATTGACGG 1062R CTCACRRCACGAGCTGAC