Skip to main content

Table 1 Quantitative RT-PCR Primer Sequences

From: Gut microbiota maturation during early human life induces enterocyte proliferation via microbial metabolites

Gene 5′-3′ Forward Primer 3′-5′ Reverse Primer
Lgr5 GCTTTGACACACATTCC CTTCTCAAATTCTGTAGCG
Ascl2 AAGCACACCTTGACTGGTACG AAGTGGACGTTTGCACCTTCA
Ephb2 GCGGCTACGACGAGAACAT GGCTAAGTCAAAATCAGCCTCA
Sox9 CATCTCTCCTAATGCTATCTTC CTGAGATTGCCCAGAGT
Fzd5 CACGGTTGTCTTCCTCTTAGTC ACCTGCGATGGCTTCATT
Lyz1 GCCGATACTGGTGTAATG CTCTCACCACCCTCTTT
Muc2 CCATCTCTACCACCATTAC CTCGATCACCACCATTT
Chga GTCCTGGAAGTCATCTC AGTTCCTTCAGCAGATT
Chop AGGAAACGAAGAGGAAGAA CTGACTGGAATCTGGAGAG
TNF-α ATGAGCACAGAAAGCATGATC TACAGGCTTGTCACTCGAATT
IFNγ ACGCTTATGTTGTTGCTGATGG CTTCCTCATGGCTGTTTCTGG
β-actin TGGCGTGAGGGAGAGXXXAGX AGCCATGTACGTAGCCATCCA