Skip to main content

Table 4 Primers used in this work

From: Effect of deletion of gene cluster involved in synthesis of Enterobacterial common antigen on virulence and immunogenicity of live attenuated Salmonella vaccine when delivering heterologous Streptococcus pneumoniae antigen PspA

Primer Sequence from 5’to 3´
Doperon-1F
Doperon-1R
Doperon-2F
Doperon-2R
CCATCCGATGGGTGAAATTG
AGGGAGACCTGCAGGACGCCAGCTCCTAGAAGAGAC
TGGCGTCCTGCAGGTCTCCCTTCTGATGACTTGAG
GATATACGCCAGCAGCACTG