Skip to main content

Table 2 Primers and conditions used in RT-PCR for cytokine gene expression analysis

From: Biofilm growth and IL-8 & TNF-α-inducing properties of Candida albicans in the presence of oral gram-positive and gram-negative bacteria

Target gene Primer sequence 5′-3′ Size (bp) Annealing temperatures (°C) References
TNF-α F: GAAACCTGGGATTCAGGAATG
R: GTCTCAAGGAAGTCTGGAAAC
246 55 [56]
IL-8 F: GCAGCTCTGTGTGAAGGTGCAG
R: GCATCTGGCAACCCTACAACAG
365 55 [58]
GAPDH F: ATCACCATCTTCCAGGAG
R: ATCGACTGTGGTCATGAG
318 55 [59]