Skip to main content

Table 3 Primer nucleotide sequences used in qRT-PCR assay

From: Seasonal variation in gut microbiota composition: cross-sectional evidence from Ukrainian population

Phylum Primer nucleotide sequence
Forward Reverse
Bacteroidetes 798cfbF AAACTCAAAKGAATTGACGG cfb967R GGTAAGGTTCCTCGCGCTAT
Firmicutes 928F-firm TGAAACTYAAGGAATTGACG 1040FirmR ACCATGCACCACCTGTC
Actinobacteria Act920F3 TACGGCCGCAAGGCTA Act1200R TCRTCCCCACCTTCCTCCG
16S rRNA gene 926F AAACTCAAAKGAATTGACGG 1062R CTCACRRCACGAGCTGAC