Skip to main content

Table 3 Primer nucleotide sequences used in qRT-PCR assay

From: Seasonal variation in gut microbiota composition: cross-sectional evidence from Ukrainian population

PhylumPrimer nucleotide sequence
ForwardReverse
Bacteroidetes798cfbF AAACTCAAAKGAATTGACGGcfb967R GGTAAGGTTCCTCGCGCTAT
Firmicutes928F-firm TGAAACTYAAGGAATTGACG1040FirmR ACCATGCACCACCTGTC
ActinobacteriaAct920F3 TACGGCCGCAAGGCTAAct1200R TCRTCCCCACCTTCCTCCG
16S rRNA gene926F AAACTCAAAKGAATTGACGG1062R CTCACRRCACGAGCTGAC