Skip to main content

Table 2 Amplicon sizes (base pairs) obtained from multiplex PCR amplification using yeast specific (Universal-UNI1 and UNI2) and corresponding species-specific primers for four different Candida spp.

From: Silver diamine fluoride (SDF) used in childhood caries management has potent antifungal activity against oral Candida species

SpeciesPrimerSequence (5′-3′)Amplicon size (bp)
UNI 1
UNI 2
GTCAAACTTGGTCATTTA
TTCTTTTCCTCCGCTTATTG
C. albicansCalbAGCTGCCGCCAGAGGTCTAA583/446
C. tropicalisCtroGATTTGCTTAATTGCCCCAC583/507
C. kruseiCkruCTGGCCGAGCGAACTAGACT590/169
C. glabrataCglaTTGTCTGAGCTCGGAGAGAG929/839