Skip to main content

Table 4 Sequences of primers and probes used in this study for detection of S. pneumoniae ply and lytA genes

From: Strategy using a new antigenic test for rapid diagnosis of Streptococcus pneumoniae infection in respiratory samples from children consulting at hospital

Primer nameTypeSequences (5′ to 3′)Length (bp)Tm (°C) (GC%)Reference
ply
 SPply FForwardTGCAGAGCGTCCTTTGGTCTAT2266 (48)[27]
 SPply RReverseCTCTTACTCGTGGTTTCCAACTTGA2572 (44)[27]
 SPply TPProbeTTCGAGTGTTGCTTATGGGCGCCA2474 (54)[28]
lytA
 LytA FForwardCGCAATCTAGCAGATGAAGCAG2250 (50)Adapted from [29]
 LytA RReverseAAGGGTCAACGTGGTCTGAGT2152 (55)Adapted from [30]
 LytA PrProbeTTTGCCGAAAACGCTTGATACAGGG2553 (48)[29]