Table 4 Sequences of primers and probes used in this study for detection of S. pneumoniae ply and lytA genes
Primer name | Type | Sequences (5′ to 3′) | Length (bp) | Tm (°C) (GC%) | Reference |
|---|---|---|---|---|---|
ply | |||||
SPply F | Forward | TGCAGAGCGTCCTTTGGTCTAT | 22 | 66 (48) | [27] |
SPply R | Reverse | CTCTTACTCGTGGTTTCCAACTTGA | 25 | 72 (44) | [27] |
SPply TP | Probe | TTCGAGTGTTGCTTATGGGCGCCA | 24 | 74 (54) | [28] |
lytA | |||||
LytA F | Forward | CGCAATCTAGCAGATGAAGCAG | 22 | 50 (50) | Adapted from [29] |
LytA R | Reverse | AAGGGTCAACGTGGTCTGAGT | 21 | 52 (55) | Adapted from [30] |
LytA Pr | Probe | TTTGCCGAAAACGCTTGATACAGGG | 25 | 53 (48) | [29] |