Skip to main content

Table 3 List of oligonucleotides used in this study

From: Transaldolase in Bacillus methanolicus: biochemical characterization and biological role in ribulose monophosphate cycle

NameSequence (5–3′)
pET28b_FwGACTCACTATAGGGGAATTGTGAGCG
pET28b_RvAGATCCGGCTGCTAACAAAGCCCGA
pVWEx1_fwCACTCCCGTTCTGGATAATG
pVWEx1_rvGCTACGGCGTTTCACTTCTG
pTH1_fwCTGCCCTTCCACCTTAACC
pTH1_rvATGTCACTAACCTGCCCCG
ta_MGA3rec-RBS-fwGCGCGGATCCGAAAGGAGGCCCTTCAGATGGATGATTCAAAACAGTT
ta_MGA3rec-rvGCGCGGTACCTTATTTCCCGCGTTTATTCC
ta_PB1-RBS-fwGCGCGGATCCGAAAGGAGGCCCTTCAGATGATTCAAAACAGCATCCA
ta_PB1-rvGCGCGGTACCTTATTGCCCGCGTTTTTTCC
tal_CG-RBS-fwGCGCGGATCCGAAAGGAGGCCCTTCAGATGTCTCACATTGATGATCT
tal_CG-rvGCGCGGTACCCTACTTCAGGCGAGCTTCCA
ta_PB1-TH-fwGCGCACATGTGATTCAAAACAGCATCCAACGAAAT
ta_PB1-TH-rv,ATGCGGTACCTTATTGCCCGCGTTTTTTCC
ta_PB1_NcoI-fwAGAGCCATGGATGATTCAAAACAGCATCCA
ta_PB1_Xho-rvAGAGCTCGAGTTGCCCGCGTTTTTTCCAATCTG
ta_MGA3rec_NcoI-fwAGAGCCATGGATGATTCAAAACAGTTTCCAACCAAATAAAG
ta_MGA3rec_Xho-rvAGAGCTCGAGTTTCCCGCGTTTATTCCAGTC
tal_cg_del_AGCGCGGATCCGGCTCCGGCTCCGAGGTTCA
tal_cg_del_BCCCATCCACTAAACTTAAACAGAGCTGTGCAAGATCATCAA
tal_cg_del_CTGTTTAAGTTTAGTGGATGGGCTTGAGTCCATGGAAGCTCG
tal_cg_del_DGCGCGGATCCGCGGGTTTTGTCGATGCGCT
tal_cg_del_ECTGCGTCCTGCAGATGCGAA
tal_cg_del_FGGTCGATGCGGAACACAGAA
ta_MGA3,M1_BamHI-fwCGCGGATCCGTGTCATATTTTAATACAGTT
ta_MGA3,M2_BamHI-fwCGCGGATCCGTGTCAAAATTTAATACAGTT
ta_MGA3,M3_BamHI-fwCGCGGATCCGTGTCATTATTTAATACAGTT
ta_MGA3,M4_BamHI-fwCGCGGATCCGTGTCATCATTTAATACAGTT
ta_MGA3,M5_BamHI-fwCGCGGATCCGTGTCACAATTTAATACAGTT
ta_MGA3,M6_BamHI-fwCGCGGATCCGTGTCAGAATTTAATACAGTT
ta_MGA3,M_BamHI-rvCCCCGGATCCTTATTTCCCGCGTTTATTCC
ta_MGA3_fw 
ta_MGA3_rv 
  1. Restriction sites are highlighted in bold, linker sequences for crossover PCR and ribosomal binding sites are shown in italics, stop and start codons are underlined