Skip to main content

Table 3 Primers used in this study

From: Inactivation of the T6SS inner membrane protein DotU results in severe attenuation and decreased pathogenicity of Aeromonas veronii TH0426

PrimersNucleotide sequence
dotU-f (Xba I)CGTCTAGAGCCGAGGTGACCGAGGCGACCATGG
dotU-int-rGGAACTTCTGGCTGCTTCTTTGTACTGATTT
dotU-int-fAAGAAGCAGCCAGAAGTTCCGCGCCCATT
dotU-r (Sac I)TAGAGCTCCCGAGAGCTTGAGGGTGCCGT
dotU-e-fGCGCCATGGACGAAGTTGACC
dotU-e-rATCCGCAGCGCCAGATCGAA
dotU-i-fAGGCCACACCCACCACAGGCT
dotU-i-rCTGCAAACCCTGGCGGCTCC
dotU-p-f (Pst I)AACTGCAGTTTCCATCCTCAGTAAATAATGA
dotU-p-int-rTCAGTACAAACCGTTCGTTCCTTCATCTT
dotU-O-fGAACGAACGGATGGGCGCGGAACTTCTGC
dotU-O-r (Hind III)GCAAGCTT TCAGTACAAAGAAGCAGCAGGCC
16S-q-fGCCACGTCTCAAGGACACAG
16S-q-rTGGGGAGCAAACAGGATTAGA
dotU-q-fTCTATGGCATACCGGAAAAGG
dotU-q-rACTGAACACCGCAAAGAGCA
pRE112-fGCGATGAGTGGCAGGGC
pRE112-rTTACCGACTGCGGCCTGAGT
pBBR-fTAAGTTGGGTAACGCCAGG
pBBR-rGAGTTAGCTCACTCATTAGGC