Skip to main content

Table 2 Primer sets for multilocus sequence typing (MLST) analysis of Golovinomyces in this study

From: Multi-locus phylogeny and taxonomy of an unresolved, heterogeneous species complex within the genus Golovinomyces (Ascomycota, Erysiphales), including G. ambrosiae, G. circumfusus and G. spadiceus

DNA regions Primer Primer sequences (5′ → 3′) Annealing temperature (°C) Amplicon size (bp) Reference
ITS ITS5 ITS4 GGAAGTAAAAGTCGTAACAAGG TCCTCCGCTTATTGATATGC 52 600 [44]
28S rDNA LSU1 LSU2 ACCCGCTGAACTTAAGCATA CCTTGGTCCGTGTTTCAAGA 52 500 [45]
IGS IGS-12a NS1R AGTCTGTGGATTAGTGGCCG GAGACAAGCATATGACTAC 52 400 [46]
TUB2 TubF1 TubR1 AGGTTCACCTCCAGACTGG CCAGCACGAACAGCATCCAT 52 450 This study
CHS1 gCS1a1 gCS1b GGTGCATTCTCGGCATATCG CGTCACCCTTGGTGCCCCAAG 52 1000 This study