Skip to main content

Table 3 Primer sequences and PCR cycling conditions for the conventional PCR assays and for the identification of the mobilised colistin resistance genes

From: Exploring the antimicrobial resistance profiles of WHO critical priority list bacterial strains

Bacteria or genesPrimer NamePrimer sequence (5′ → 3′)PCR cycling conditionsGene (size/bp)Reference
A. baumanniiA.b_hyp F
A.b_hyp R
CGTCGGTCGGATCCGTGTAT AAGTAAAGTGGCAGGCGCTT95 °C for 5 min; 30 cycles of 94 °C for 30 s, 55 °C for 30 s, 72 °C for 45 s, 72 °C for 5 min545[66]
E. coliPhoF
PhoR
GTGACAAAAGCCCGGACACCATAAATGCCT TACACTGTCATTACGTTGCGGATTTGGCGT94 °C for 2 min; 35 cycles of 94 °C for 1 min, 55 °C for 1 min and 72 °C for 1 min; 72 °C for 5 min903[67]
Klebsiella spp.gryA-F
gyrA-C
CGCGTACTATACGCCATGAACGTA ACCGTTGATCACTTCGGTCAGG95 °C for 3 min; 35 cycles of 94 °C for 1 min, 50 °C for 30 s and 72 °C for 30 s; 72 °C for 5 min383[68]
Pseudomonas spp.PA-GS-F
PA-GS-R
GACGGGTGAGTAATGCCTA CACTGGTGTTCCTTCCTATA95 °C for 2 min; 25 cycles of 94 °C for 20 s, 54 °C for 20 s and 72 °C for 40 s; 72 °C for 5 min618[69]
mcr-1mcr1_320bp_fw
mcr1_320bp_rev
AGTCCGTTTGTTCTTGTGGC
AGATCCTTGGTCTCGGCTTG
94 °C for 15 min, 25 cycles at 94 °C for 30 s, 58 °C for 90 s, 72 °C for 60 s, 72 °C for 10 min320[19]
mcr-2mcr2_700bp_fw
mcr2_700bp_rev
CAAGTGTGTTGGTCGCAGTT
TCTAGCCCGACAAGCATACC
715
mcr-3mcr3_900bp_fw mcr3_900bp_revAAATAAAAATTGTTCCGCTTATG
AATGGAGATCCCCGTTTTT
929
mcr-4mcr4_1100bp_fw
mcr4_1100bp_rev
TCACTTTCATCACTGCGTTG
TTGGTCCATGACTACCAATG
1116