Skip to main content

Advertisement

Table 2 Primers for RT-qPCR

From: Effect of calcium on the interaction of Acinetobacter baumannii with human respiratory epithelial cells

Gene ID aPrimersSequences (5′–3′)Product length (bp)
Reference gene
 AF251469.1recA-F
recA-R
ACGCCCTAGACCCTCAATAT AGAGTCACCCATCTCACCTTC197
Target gene
 AY485227.1ompA-F
ompA-R
CACAGATAACACTGGTCCACG GAATACACGACGGTTCATAGC190
 AY838282.1bfmRS-F
bfmRS-R
AACAAAGTTCGGATTACGGG TCATCTAAACGGGCAAAGG128
 EU334497.1abaI-F
abaI-R
CTATTCCCTGCTCACCAGA CCCGCAGCACGTAATAAAC208
  1. a: GenBank