Skip to main content

Table 2 List of primers and PCR conditions used for amplification of virulence factors in the T. pyogenes bacteria isolated from samples of mastitis and metritis [19, 20]

From: Phenotypic and molecular characterization of antimicrobial resistance in Trueperella pyogenes strains isolated from bovine mastitis and metritis

Target genePrimer sequence (5′-3′)PCR product (bp)PCR programsPCR volume (50 μL)
nanHF: CGCTAGTGCTGTAGCGTTGTTAAGT
R: CCGAGGAGTTTTGACTGACTTTGT
7811 cycle:
94 0C ------------ 3 min.
35 cycle:
94 0C ------------ 60 s
60 0C ------------ 60 s
72 0C ------------ 3 min
1 cycle:
72 0C ------------ 7 min
5 μL PCR buffer 10X
1.5 mM Mgcl2
200 μM dNTP (Fermentas)
0.5 μM of each primers F & R
1.25 U Taq DNA polymerase (Fermentas)
2.5 μL DNA template
nanPF: TTGAGCGTACGCAGCTCTTC
R: CCACGAAATCGGCCTTATTG
150
cbpAF: GCAGGGTTGGTGAAAGAGTTTACT
R: GCTTGATATAACCTTCAGAATTTGCA
124
fimCF: TGTCGAAGGTGACGTTCTTCG
R: CAAGGTCACCGAGACTGCTGG
843
ploF: GGCCCGAATGTCACCGC
R: AACTCCGCCTCTAGCGC
2701 cycle:
94 0C ------------ 2 min
35 cycle:
94 0C ------------ 60 s
55 0C ------------ 60 s
72 0C ------------ 60 s
1 cycle:
72 0C ------------ 5 min
5 μL PCR buffer 10X
2 mM Mgcl2
150 μM dNTP (Fermentas)
0.75 μM of each primers F & R
1.5 U Taq DNA polymerase (Fermentas)
3 μL DNA template
fimAF: CACTACGCTCACCATTCACAAG
R: GCTGTAATCCGCTTTGTCTGTG
6051 cycle:
94 0C ------------ 3 min.
35 cycle:
94 0C ------------ 60 s
57 0C ------------ 60 s
72 0C ------------ 3 min
1 cycle:
72 0C ------------ 7 min
5 μL PCR buffer 10X
2 mM Mgcl2
150 μM dNTP (Fermentas)
0.75 μM of each primers F & R
1.5 U Taq DNA polymerase (Fermentas)
3 μL DNA template
fimGF: ACG CTT CAG AAG GTC ACC AGG
R: ATC TTG ATC TGC CCC CAT GCG
929
fimEF: GCCCAGGACCGAGAGCGAGGGC
R: GCCTTCACAAATAACAGCAACC
7751 cycle:
94 0C ------------ 3 min.
35 cycle:
94 0C ------------ 60 s
55 0C ------------ 60 s
72 0C ------------ 3 min
1 cycle:
72 0C ------------ 7 min
5 μL PCR buffer 10X
2 mM Mgcl2
150 μM dNTP (Fermentas)
0.75 μM of each primers F & R
1.5 U Taq DNA polymerase (Fermentas)
3 μL DNA template
\