Skip to main content

Table 1 List of primers and PCR conditions used for amplification of antibiotic resistance genes in the T. pyogenes bacteria isolated from samples of mastitis and metritis [14,15,16,17,18]

From: Phenotypic and molecular characterization of antimicrobial resistance in Trueperella pyogenes strains isolated from bovine mastitis and metritis

Target genePrimer sequence (5′-3′)PCR product (bp)PCR programsPCR volume (50 μL)
Class 1 intIF: CCTCCCGCACGATGATC2801 cycle:5 μL PCR buffer 10X
R: TCCACGCATCGTCAGGC 95 0C ------------ 3 min2 mM Mgcl2
Class 1 cassetteF: GGCATCCAAGCAGCAAG
R: AAGCAGACTTGACCTGA
Unpredictable35 cycle:
94 0C ------------ 60 s
150 μM dNTP (Fermentas)
0.75 μM of each primers F & R
  58 0C ------------ 60 s
72 0C ------------ 60 s
1 cycle:
72 0C ------------ 5 min
1.5 U Taq DNA polymerase (Fermentas)
1 μL DNA template
Class 2 intIF: TTATTGCTGGGATTAGGC
R: ACGGCTACCCTCTGTTATC
2331 cycle:
94 0C ------------ 4 min.
35 cycle:
94 0C ------------ 60 s
56 0C ------------ 60 s
72 0C ------------ 45 s
1 cycle:
72 0C ------------ 7 min
5 μL PCR buffer 10X
2 mM Mgcl2
150 μM dNTP (Fermentas)
0.75 μM of each primers F & R
1 U Taq DNA polymerase (Fermentas)
1.5 μL DNA template
tetWF: GACAACGAGAACGGACACTATG
R: CGCAATAGCCAGCAATGAACGC
18431 cycle:
94 0C ------------ 2 min.
35 cycle:
94 0C ------------ 60 s
55 0C ------------ 60 s
72 0C ------------ 60 min
1 cycle:
72 0C ------------ 5 min
5 μL PCR buffer 10X
2 mM Mgcl2
150 μM dNTP (Fermentas)
0.75 μM of each primers F & R
1.5 U Taq DNA polymerase (Fermentas)
3 μL DNA template
ermXF:GTTGCGCTCTAACCGCTAAGGC
R:CCATGGGGACCACTGAGCCGTC
571/6571 cycle:
94 0C ------------ 2 min.
35 cycle:
94 0C ------------ 60 s
55 0C ------------ 60 s
72 0C ------------ 60 min
1 cycle:
72 0C ------------ 6 min
5 μL PCR buffer 10X
2 mM Mgcl2
150 μM dNTP (Fermentas)
0.75 μM of each primers F & R
1.5 U Taq DNA polymerase (Fermentas)
3 μL DNA template
ermBF: GAAATTGGAACAGGTAAAGG
R: TTTACTTTTGGTTTAGGATG
4041 cycle:
94 0C ------------ 60 s.
35 cycle:
94 0C ------------ 60 s
53 0C ------------ 60 s
72 0C ------------ 60 s
1 cycle:
72 0C ------------ 5 min
5 μL PCR buffer 10X
2 mM Mgcl2
150 μM dNTP (Fermentas)
0.75 μM of each primers F & R
1.5 U Taq DNA polymerase (Fermentas)
3 μL DNA template
\