Skip to main content

Table 2 Primers for amplification of diarrheic E. coli virulence genes by conventional PCR

From: Prevalence and antibiotic susceptibility patterns of enteric bacterial pathogens in human and non-human sources in an urban informal settlement in Cape Town, South Africa

  Target genes Primers Primer sequence Product size Reference
A Eae eae-F TCAATGCAGTTCCGTTATCAGTT 482 bp [20, 21]
eae-R GTAAAGTCCGTTACCCCAACCTG
Bfp bfp-F GGAAGTCAAATTCATGGGGGTAT 298 bp [21]
bfp-R GGAATCAGACGCAGACTGGTAGT
stx 1 stx1-F CAGTTAATGTGGTGGCGAAGG 348 bp [22]
stx1-R CACCAGACAATGTAACCGCTG
stx 2 stx2-F ATCCTATTCCCGGGAGTTTACG 584 bp [22]
stx2-R GCGTCATCGTATACACAGGAGC
B Est ST-F ATTTTTCTTTCTGTATTGTCTT 190 bp [19]
ST-R CACCCGGTACAAGCAGGATT
Elt LT-F GGCGACAGATTATACCGTGC 440 bp [19]
LT-R CGGTCTCTATATTCCCTGTT
C Ipa ipaH-F CTCGGCACGTTTTAATAGTCTGG 933 bp [21]
ipaH-R GTGGAGAGCTGAAGTTTCTCTGC
Aat pCVD432-F CTGGCGAAAGACTGTATCAT 630 bp [19]
pCVD432-R CAATGTATAGAAATCCGCTGTT
daaC daaC-F CAGGTCATCCGGTCAGTCGG 212 bp [19]
daaC-R CAATGCCACGTACAACCGGC