Skip to main content

Table 1 Primers and probes for the duplex real-time PCR assay

From: Prevalence and antibiotic susceptibility patterns of enteric bacterial pathogens in human and non-human sources in an urban informal settlement in Cape Town, South Africa

Primer/probe 5́ Dye Sequence 3́ Dye Reference
stx1a-primer   CAAGAGCGATGTTACGGT   [18]
stx1b-primer AATTCTTCCTACACGAACAGA [17]
stx1f-probe CTGGGGAAGGTTGAGTAGCG Fluorescein [17]
stx1r-probe CALFluor 610 CCTGCCTGACTATCATGGACA 3′ phosphor [17]
stx2a-primer   GGGACCACATCGGTGT [17]
stx2b-primer CGGGCACTGATATATGTGTAA [17]
stx2f-probe CTGTGGATATACGAGGGCTTGATGTC Fluorescein [17]
stx2r-probe CAL Fluor 610 ATCAGGCGCGTTTTGACCATCT 3′ phosphor [17]