Skip to main content

Advertisement

Table 2 The primers used in this study

From: Amikacin resistance due to the aphA6 gene in multi-antibiotic resistant Acinetobacter baumannii isolates belonging to global clone 1 from Iran

Target Primer Sequence (5′-3′) Annealing temperature (°C) Amplicon length (bp) Reference
aphA6 aphA6F CATTTGCGGGGTTTTTAATG 59 837 This study
aphA6R TTAGATAATGCTTGGAATCA
ISAba125-aphA6 RH573 AAGAAGGCTTTTCAGCCAGA 58 1427 [8]
aphA6R GGACAATCAATAATAGCAAT [22]
aphA6-ISAba125 aphA6F ATACAGAGACCACCATACAGT 58 1745 [22]
RH574 CAAACATGAGGTGCGACAGT [8]
repAci6 gr6FW AGCAAGTACGTGGGACTAAT 59 662 [12]
gr6RV AAGCAATGAAACAGGCTAAT [12]
TnaphA6_L RH1501 CTTGAGGAAGGGATGGTTGA 59 1930 [9]
aphA6R GGACAATCAATAATAGCAAT [22]
TnaphA6_R aphA6F ATACAGAGACCACCATACAGT 59 2540 [22]
RH1502 TTGCTTTAATCGGTGGTTCC [9]
Repeated sequence 1 RH1398 TTTGACGTTGCTCTTGTTGC 58 991 [9]
RH1399 TTCTCCCAAGTGGTCAGGTC [9]
Repeated sequence 2 RH1394 TGGTTGGCAGAACAAGATGA 58 1372 [9]
RH1395 TCAAACGATGCAATGGAAGA [9]
Repeated sequence 3 RH1503 GAAGATCCAGAAGCGGGATA 58 1575 [9]
RH1397 CCATGTTCTTTTCCACATGC [9]