Skip to main content

Table 1 Primers’ sequence used in multiplex PCR for amplification of stx1, stx2 and eaeA genes

From: Escherichia coli O157:H7: distribution, molecular characterization, antimicrobial resistance patterns and source of contamination of sheep and goat carcasses at an export abattoir, Mojdo, Ethiopia

Target gene Primers sequence (5′-3′) (Forward/reverse) Amplicon size (bp) Reference
stx1 ATAAATCGCCATTCGTTGACTAC/ AGAACGCCCACTGAGATCATC 180 [27]
stx2 GGCACTGTCTGAAACTGCTCC/ TCGCCAGTTATCTGACATTCTG 255 [27]
eaeA GACCCGGCACAAGCATAAGC/ CCACCTGCAGCAACAAGAGG 384 [29]