Skip to main content

Table 2 Primers used to detect virulence genes

From: Serotype, antimicrobial susceptibility and genotype profiles of Salmonella isolated from duck farms and a slaughterhouse in Shandong province, China

Virulence Gene Primer Sequence Reference
hilA F: 5′- CGTGAAGGGATTATCGCAGT −3′ Fardsanei et al., 2017 [25]
R: 5′- GTCCGGGAATACATCTGAGC −3′
invA F: 5′- ACAGTGCTCGTTTACGACCTGAAT − 3′ Fardsanei et al., 2017 [25]
R: 5′- AGACGACTGGTACTGATCGATAAT − 3′
pefA F: 5′- TTGCACTGGGTGGTTCTGG − 3′ Fardsanei et al., 2017 [25]
R: 5′- TGTAACCCACTGCGAAAG − 3′
rck F: 5′- AACGGACGGAACACAGAGTC − 3′ Fardsanei et al., 2017 [25]
R: 5′- TGTCCTGACGAAAGTGCATC − 3′
sefA F: 5′- GCAGCGGTTACTATTGCAGC − 3′ Fardsanei et al., 2017 [25]
R: 5′- TGTGACAGGGACATTTAGCG − 3′
sipA F: 5′- CCATTCGACTAACAGCAGCA − 3′ Fardsanei et al., 2017 [25]
R: 5′- CGGTCGTACCGGCTTTATTA − 3′
sipC F: 5′- AGACAGCTTCGCAATCCGTT − 3′ Fardsanei et al., 2017 [25]
R: 5′- ATTCATCCCTTCGCGCATCA − 3′
sopB F: 5′- CCTCAAGACTCAAGATG − 3′ Fardsanei et al., 2017 [25]
R: 5′- TACGCAGGAGTAAATCGGTG − 3′
sopE F: 5′- CGAGTAAAGACCCCGCATAC − 3′ Fardsanei et al., 2017 [25]
R: 5′- GAGTCGGCATAGCACACTCA − 3′
spvC F: 5′- ACTCCTTGCACAACCAAATGCGGA − 3′ Fardsanei et al., 2017 [25]
R: 5′- TGTCTCTGCATTTCGCCACCATCA − 3′
ssaR F: 5′- GTTCGGATTTGCTTCGG − 3′ Fardsanei et al., 2017 [25]
R: 5′- TCTCCAGTGACTAACCCTAACCAA − 3′
ssrA F: 5′- CTTACGATTACGCCATTTACGG − 3′ Fardsanei et al., 2017 [25]
R: 5′- ATTTGGTGGAGCTGGCGGGACT − 3′
stnP1 F: 5′- TTGTCTCGCTATCACTGGCAACC − 3′ Fardsanei et al., 2017 [25]
R: 5′- ATTCGTAACCCGCTCTCGTCC − 3′