Skip to main content

Table 1 Primers used to detect antimicrobial-resistance genes

From: Serotype, antimicrobial susceptibility and genotype profiles of Salmonella isolated from duck farms and a slaughterhouse in Shandong province, China

Resistance Gene Category Resistance Gene Primer Sequence Reference
β-lactamase bla TEM F: 5′- ATAAAATTCTTGAAGACGAAA − 3′ Ahmed et al., 2007 [18]
R: 5′- GACAGTTACCAATGCTTAATC − 3′
bla SHV F: 5′- TTATCTCCCTGTTAGCCACC − 3′ Ahmed et al., 2007 [18]
R: 5′- GATTTGCTGATTTCGCTCGG − 3′
bla PSE F: 5′- TAGGTGTTTCCGTTCTTG-3′ Puah et al., 2012 [19]
R: 5′- TCATTTCGCTCTTCCATT-3′
bla OXA F: 5′- TCAACTTTCAAGATCGCA-3′ Ahmed et al., 2007 [18]
R: 5′- GTGTGTTTAGAATGGTGA-3′
bla CMY-2 F: 5′- ACGGAACTGATTTCATGATG − 3′ Ahmed et al., 2007 [18]
R: 5′- GAAAGGAGGCCCAATATCCT −3′
bla CTX-M F: 5′- CGCTTTGCGATGTGCAG-3′ Ahmed et al., 2007 [18]
R: 5′- ACCGCGATATCGTTGGT-3′
Quinolone qnrA F: 5′- ATTTCTCACGCCAGGATTTG-3′ Ahmed et al., 2007 [18]
R: 5′- GATCGGCAAAGGTCAGGTCA-3′
qnrB F: 5′- GATCGTGAAAGCCAGAAAGG-3′ Ahmed et al., 2007 [18]
R: 5′- ACGATGCCTGGTAGTTGTCC-3′
qnrC F: 5′- GGTTGTACATTTATTGAATC-3′ Ahmed et al., 2007 [18]
R: 5′- TCCACTTTACGAGGTTCT −3′
qnrD F: 5′- AGATCAATTTACGGGGAATA-3′ Ahmed et al., 2007 [18]
R: 5′- AACAAGCTGAAGCGCCTG − 3′
qnrS F: 5′- ACGACATTCGTCAACTGCAA-3′ Ahmed et al., 2007 [18]
R: 5′- TAAATTGGCACCCTGTAGGC-3′
oqxA F: 5′- GATCAGTCAGTGGGATAGTTT-3′ Liao et al., 2015 [20]
R: 5′- TACTCGGCGTTAACTGATTA-3′
aac(6′)-Ib-cr F: 5′- TTGCGATGCTCTATGAGTGGCTA − 3′ Ahmed et al., 2007 [18]
R: 5′- CTCGAATGCCTGGCGTGTTT − 3′
Aminoglycosides aaC1 F: ACCTACTCCCAACATCAGCC-3′ Navajas-Benito et al., 2016 [21]
R: ATATAGATCTCACTACGCGC-3′
aaC2 F:ACTGTGATGGGATACGCGTC-3′ Navajas-Benito et al., 2016 [21]
R: CTCCGTCAGCGTTTCAGCTA-3′
aaC3 F: CACAAGAACGTGGTCCGCTA-3′ Navajas-Benito et al., 2016 [21]
R: AACAGGTAAGCATCCGCATC-3′
aaC4 F: CTTCAGGATGGCAAGTTGGT-3′ Navajas-Benito et al., 2016 [21]
R: TCATCTCGTTCTCCGCTCAT-3′
Ant(2′) F: ATGTTACGCAGCAGGGCAGTCG-3′ Navajas-Benito et al., 2016 [21]
R: CGTCAGATCAATATCATCGTGC-3′
Tetracycline tetA F: 5′- GCGCCTTTCCTTTGGGTTCT-3′ Navajas-Benito et al., 2016 [21]
R: 5′- CCACCCGTTCCACGTTGTTA-3′
tetB F: 5′- CATTAATAGGCGCATCGCTG-3′ Navajas-Benito et al., 2016 [21]
R: 5′- TGAAGGTCATCGATAGCAGG-3′
Sulfonamides sul1 F: 5′- CTTCGATGAGAGCCGGCGGC-3′ Aarestrup et al., 2003 [22]
R: 5′- GCAAGGCGGAAACCCGCGCC-3′
sul2 F: 5′- GCGCTCAAGGCAGATGGCATT-3′ Aarestrup et al., 2003 [22]
R: 5′- GCGTTTGATACCGGCACCCGT-3′
sul3 F: 5′- AGATGTGATTGATTTGGGAGC-3′ Zhang et al., 2009 [23]
R: 5′- TAGTTGTTTCTGGATTAGAGCCT-3′
Chloramphenicol cmlA F: 5′- TGTCATTTACGGCATACTCG-3′ Guerra et al., 2001 [24]
R: 5′- ATCAGGCATCCCATTCCCAT-3′
stcM F: 5′- CACGTTGAGCCTCTATATGG-3′ Guerra et al., 2001 [24]
R: 5′- ATGCAGAAGTAGAACGCGAC-3′