Skip to main content

Advertisement

Table 2 Primer and probe sequences for V. parahaemolyticus real-time PCR, RPA and real-time RPA assay

From: Development and evaluation of a rapid and sensitive RPA assay for specific detection of Vibrio parahaemolyticus in seafood

Method Name Sequence 5′-3’Amplication size (bp)
Real-time RPA RPA-FP CGAAGAAAGCGAAAACGGCAACGTCAGGCGA 168
RPA-RP CAGATAATTTCTCACCCATCGCCGATTCAACC
exo Probe GGTTTGACAGCCGTTGTTTCAGTAAAAGTGCC [FAM-dT]-THF-[BHQ-dT]TCCAAAATTCTCGAGCC
Real-time PCR PCR-FP CGGTAGTAAACGCACTGTCAGAA 77
PCR-RP ACGGTAAGTTTGCGTGTGGAT
PCR-Probe FAM- TGGTACTAACCATCCATCGTGGCGGTC -BHQ1