Skip to main content

Advertisement

Table 3 RT-qPCR primer sequences (5′ to 3′)

From: Dietary fat intake and age modulate the composition of the gut microbiota and colonic inflammation in C57BL/6J mice

Gene Primer sequence (5′ → 3′)
TNF-α Forward: CATCTTCTCAAAATTCGAGTGACAA
Reverse: TGGGAGTAGACAAGGTACAACCC
IL-1β Forward: TCACAGCAGCACATCAACAA
Reverse: TGTCCTCATCCTGGAAGGTC
IL-6 Forward: ACTCACCTCTTCAGAACGAATTG
Reverse: CCATCTTTGGAAGGTTCAGGTTG
Claudin-1 Forward: TCTACGAGGGACTGTGGATG
Reverse: TCAGATTCAGCTAGGAGTCG
E-Cadherin Forward: CCACCAAAGTCACGCTGAATAC
Reverse: GGAGTTGGGAAATGTGAGCAA
Occludin Forward: ACTGGGTCAGGGAATATCCA
Reverse: TCAGCAGCAGCCATGTACTC
ZO-1 Forward: AGGCTACCTTTGTATTCTC
Reverse: TAGGGCACAGTATTGTATC
β-Actin Forward: CTCCTACCACACCCATTCTCATCC
Reverse: GCAATGCCTGGGTACATGGTGG