Skip to main content

Advertisement

Table 2 Primers used in this study

From: Differential gene content and gene expression for bacterial evolution and speciation of Shewanella in terms of biosynthesis of heme and heme-requiring proteins

PrimerOligonucleotide sequence (5′-3′)
Complementation
 MR1-hemH1-F5′- GTGAGCTCTATGCGACTGAATGTTAGCC − 3′
 MR1-hemH1-R5′- GCTCTAGATCATTCTGCACTTATCCAAG − 3′
 MR1-HemH2-F5′- GGAATTCAGAAATGGGTCACGCTGC − 3′
 MR1-HemH2-R5′- GCTCTAGAGCTTACAGATACGGCTTCACC − 3′
 PV4-hemH1-F5′- GGAATTCTAAAGTGAAGCGCTATATGAGC − 3′
 PV4-hemH1-R5′- GCTCTAGAGCAGTGATTTATGCCGTTTACC − 3’
 pET28a-KatB-F5′- GGAATTCATGAGTCAACAGTATTTAAC − 3’
 pET28a-KatB-R5′- GCAAGCTTTTATAACCCCAGCGCCATTTTG − 3’
 pET28a-cymA-F5′- GGAATTCATGAACTGGCGTGCACTATTT − 3’
 pET28a-cymA-R5′- GCAAGCTTTTATCCTTTTGGATAGGGGTG − 3’
Mutagenesis
 MR-hemH1_5O5′- CAGAGCTCTCGTCGGCCAAAATAGAATA-3’
 MR-hemH1_5I5′- GACTGGCTTAGGTCGTCTCTCCAAGGCGTGAAAAGTGTCG-3’
 MR-hemH1_3I5′- AGAGACGACCTAAGCCAGTCGACGACCCGAGGATCACTTA-3’
 MR-hemH1_3O5′- GTGAGCTCGATGGCGGCAAACGGTATTA − 3’
 MR-hemH2_5O5′- CAGAGCTCGATGAACGCTAAAACCGTA − 3’
 MR-hemH2_5I5′- GACTGGCTTAGGTCGTCTCTCGCTCAATGATAATGATGA − 3’
 MR-hemH2_3I5′- AGAGACGACCTAAGCCAGTCGGATAGCTTAGCCGTTTGT − 3’
 MR-hemH2_3O5′- GTGAGCTC ACTGCGAGTAATTGTGGTT − 3’
 PV4-hemH1_5O5′- AGAGCTCGTACGTTCACCGCACTCTGA − 3’
 PV4-hemH1_5I5′- TGCATCGAGTTGATTGTCGCATCACTGCCCGATGCTATTT − 3’
 PV4-hemH1_3I5′- GCGACAATCAACTCGATGCATAGGCTAGCACCCACCCTTG − 3’
 PV4-hemH1_3O5′- AGAGCTCGTTAAAGCGGGAACGCCTCT − 3’
QRT-PCR
 QRT-PV4-hemH1-F5′- CAGTGTCAACGTACTGCCGA − 3’
 QRT-PV4-hemH1-R5′- ATAAAGCTCTCCTTGCCGCC − 3’
 QRT-PV4-hemH2-F5′- ATTTCTGCATGCGTTACGGC − 3’
 QRT-PV4-hemH2-R5′- GCCAGCGCCGCAATATAATC − 3’
 QRT-MR-hemH1-F5′- CAACGGATTTAAGCGCCACCT − 3’
 QRT-MR-hemH1-R5′- CTGACCATGGGTTTTCCAATG − 3’
 QRT-MR-hemH2-F5′- GGTTTTACCGCTCTATCCGC − 3’
 QRT-MR-hemH2-R5′- CCGTATAGGGTTGCAACCAC − 3’
 QRT-MR-rpoE2-F5′- CGGGTACAGCATAACCGAGAAG − 3’
 QRT-MR-rpoE2-R5′- AATCATGTTGTGTCTCCAAAAAGC − 3’
 QRT-MR-cymA-F5′- CAAGTACAGATGCGTTCTG − 3’
 QRT-MR-cymA-R5′- GTAAGCCAATGCTTTGTCG − 3’
 QRT-MR-napB-F5′- GGATTAGGCTTAACGGCTACGGC − 3’
 QRT-MR- napB -R5′- TGTGGGTAAAAACATGGCGTG − 3’
 QRT-MR-hmuX-F5′- CCAGATTTAATGCCTGCACAA − 3’
 QRT-MR-hmuX-R5′- GCATGCCATCCAATTTAAGAT − 3’
 QRT-MR-exbB-F5′- GCATTCCTCGCCTTGATGAT − 3’
 QRT-MR-exbB-R5′- GCTTGCAGCTCCCTTTGTTG − 3’
 QRT-MR-hmuC-F5′- GATCGTTTATCGTCTGGCGAG − 3’
 QRT-MR-hmuC-R5′- GCTTCAGCTTCACCCAGTAGC − 3’
 QRT-MR-hemA-F5′- CACAGTTGCCTTAACCATTG − 3’
 QRT-MR-hemA-R5′- CTCACACATGCTTTGGGCAC − 3’
 QRT-MR-hemB-F5′- GCAACGCGCAGTGCGTGAAC − 3’
 QRT-MR-hemB-R5′- GTAGGCCATGATTTGAGTG − 3’
 QRT-MR-hemD-F5′- CTGACGATACGTTTAAAGCC − 3’
 QRT-MR-hemD-R5′- GCTTCACGGCCACCAACAC − 3’
 QRT-MR-hemF-F5′- CACCCATGCCAACGTGCGC − 3’
 QRT-MR-hemF-R5′- CTTTTATCGAAGCCTGCTTG − 3’
 QRT-MR-hemG-F5′- CAGATGTTGATAAGGTATTG − 3’
 QRT-MR-hemG-R5′- CAGATCATTGTGCGGTCGAA − 3’
 QRT-16S-F5′- TAATGGCTCACCAAGGCGAC − 3’
 QRT-16S-R5′- GGAGTTAGCCGGTCCTTCTTC − 3’
RT-PCR
 MR-hemH1-FTF5′- CAACGGATTTAAGCGCCACCT − 3’
 MR -hemH1-RTR5′- CTGACCATGGGTTTTCCAATG − 3’
 MR -hemH2-FTF5′- GGTTTTACCGCTCTATCCGC − 3’
 MR -hemH2-RTR5′- CCGTATAGGGTTGCAACCAC − 3’
 MR -rpoE2-FTF5′- CGGGTACAGCATAACCGAGAAG − 3’
 MR -rpoE2-RTR5′- AATCATGTTGTGTCTCCAAAAAGC − 3’
 16S rRNA-FT-F5′-GTTGGAAACGACTGCTAATACC − 3’
 16S rRNA-RT-R5′-GGTCCTTCTTCTGTAGGTAACG − 3’