Skip to main content

Advertisement

Table 1 The DNA sequence of the primers used in the RT-qPCR studies

From: The dimerization interface in VraR is essential for induction of the cell wall stress response in Staphylococcus aureus: a potential druggable target

Primer name Primer Sequence 5′ > 3′
vraRDir TTTGAACCGGAAGTTTTAGTG
vraRRev TCCATTTCTCGTTCTGTAAGC
sgtBDir CCTTTCAAATCGAATCCATGA
sgtBRev TCAGCTGATAACATGCCAGAG
fmtADir TGGTACGAAAAAGTATCCAGATG
fmtARev CCAAAGAATCCCCCGTTAAG
pbp2Dir GAACATGGCGCACTTGATTA
pbp2Rev GAGGCACCTTCAGAACCAAA