Skip to main content

Advertisement

Table 3 Primer sequences for real-time PCR

From: Lactobacillus plantarum C88 protects against aflatoxin B1-induced liver injury in mice via inhibition of NF-κB–mediated inflammatory responses and excessive apoptosis

GenePrimer sequenceNCBI Reference Sequence:References
NF-κB p65Forward 5′ - GGACAGCACCACCTACGATG - 3′Reverse 5′ - CTGGATCACTTCAATGGCCTC - 3’NM_009045.4Present study
I-κBForward 5’ - CAGGAGCCAAAACCGACAAC - 3′Reverse 5′ - TGGTTGTCAGGTCTGCAATTTT - 3’NM_001306222.1Present study
FasForward 5’ - CCAAACGGAAATTGCAGGGG - 3′Reverse 5′ - AAGCACCAGTTCACAGATGGA - 3’NM_001146708.1Present study
FADDForward 5’ - TGCTCCACCTATCCACCAGA - 3′Reverse 5′ - CAATGCGGAAGGCGATTGAG - 3’NM_010175.6Present study
TRADDForward 5’ - GAGCTGCTGGAGTGCAACTA - 3′Reverse 5′ - GGTCCGGGTACTTAGAGGGT - 3’NM_001033161.2Present study
Caspase-8Forward 5’ - CCAGACAGAGAAGGGGCTTG - 3′Reverse 5′ - TCACTGCCCAGTTCTTCAGC - 3’NM_001080126.1Present study
IL-1βForward 5’ - TCGTGCTGTCGGACCCATAT - 3′Reverse 5′ - GTCGTTGCTTGGTTCTCCTTGT - 3’NM_008361.4Present study
IL-6Forward 5’ - GACAAAGCCAGAGTCCTTCAGA - 3′Reverse 5′ - TGTGACTCCAGCTTATCTCTTGG - 3’NM_001314054.1Present study
TNF-αForward 5’ - GCGGAGTCCGGGCAGGTCTA - 3′Reverse 5′ - GGGGGCTGGCTCTGTGAGGA - 3’NM_001278601.1Present study
β-actinForward 5’ - TGCTGTCCCTGTATGCCTCTG - 3′Reverse 5′ - TTGATGTCACGCACGATTTCC - 3’NM_007393.4Present study