Skip to main content

Table 3 Primer sequences for real-time PCR

From: Lactobacillus plantarum C88 protects against aflatoxin B1-induced liver injury in mice via inhibition of NF-κB–mediated inflammatory responses and excessive apoptosis

GenePrimer sequenceNCBI Reference Sequence:References
NM_009045.4Present study
NM_001306222.1Present study
NM_001146708.1Present study
NM_010175.6Present study
NM_001033161.2Present study
Caspase-8Forward 5’ - CCAGACAGAGAAGGGGCTTG - 3′
NM_001080126.1Present study
NM_008361.4Present study
NM_001314054.1Present study
NM_001278601.1Present study
β-actinForward 5’ - TGCTGTCCCTGTATGCCTCTG - 3′
NM_007393.4Present study