Skip to main content

Table 1 Designed primers and fragment Tm of the amplified fragments for multiplex real-time PCR

From: Rapid detection and molecular survey of blaVIM, blaIMP and blaNDM genes among clinical isolates of Acinetobacter baumannii using new multiplex real-time PCR and melting curve analysis

Resistance genes Primer (5′-3′) Fragment length (bp) Fragment melting Temprature (°C)
IMP F: TTGACACTCCATTTACTGCTA
R: TCATTTGTTAATTCAGATGCATA
172 83.5
VIM F: GAGTTGCTTTTGATTGATACAG
R: TCGATGAGAGTCCTTCTAGA
247 93.3
NDM F: AACACAGCCTGACTTTCG
R: TGATATTGTCACTGGTGTGG
111 89.3