Skip to main content

Table 3 Primers used for virulence genes detection of Listeria monocytogenes strains

From: Genetic characteristics and virulence of Listeria monocytogenes isolated from fresh vegetables in China

Genes Sequences (5′-3′) Tm (°C) Length (bp) Reference
prfA CTGTTGGAGCTCTTCTTGGTGAAGCAATCG 60 1060 [35]
AGCAACCTCGGTACCATATACTAACTC
mpl ATAGCTTTTCAGGCTCATTTCA 60 1184 this study
ATAGCTTTTCAGGCTCATTTCA
plcA CTGCTTGAGCGTTCATGTCTCATCCCCC 60 1484 [35]
CATGGGTTTCACTCTCCTTCTAC
inlB GATATTGTGCCACTTTCAGGT 60 367 [36]
CCTCTTTCAGTGGTTGGGT
plcA CTGCTTGAGCGTTCATGTCTCATCCCCC 60 436 [37]
CATGGGTTTCACTCTCCTTCTAC
hly CTTGCAACTGCTCTTTAGTAACAGC 60 706 [38]
ACAAGCTGCACCTGTTGCAG
iap ACAAGCTGCACCTGTTGCAG 60 131 [39]
TGACAGCGTGTGTAGTAGCA
actA CGCCGCGGAAATTAAAAAAAGA 60 839 [40]
ACGAAGGAACCGGGCTGCTAG
llxS TTATTGCATCAATTGTTCTAGGG 52 200 [41]
CCCCTATAAACATCATGCTAGTG
ptsA a TCCTTTTTCTTTGTTGCGGA 52 450 [13]
TCTGAAGCTGTACGAAGACA
  1. a Tm (°C) with slight modification