Skip to main content

Table 3 Oligodeoxynucleotides used in this study

From: High-level extracellular production of recombinant nattokinase in Bacillus subtilis WB800 by multiple tandem promoters

Primers Sequence (5′-3′) Description
P0-F GGCAAGGGTTTAAAGGTGGAGATTTTTTGAGTGTCGACATGAAAAAAAGAAAGAGGCGAAAC Upstream for pMA0911-wapA-pro-NK construction
P0-R CCTTTTAAAGTTTCGCCTCTTTCTTTTTTTCATGTCGACACTCAAAAAATCTCCACCTTTAAACC Downstream for pMA0911-wapA-pro-NK construction
P1 GGCAAGGGTTTAAAGGTGGAGATTTTTTGAGTTGATAGGTGGTATGTTTTCGCTTGAAC Upstream of PP43
P2 CCTTTTAAAGTTTCGCCTCTTTCTTTTTTTCATGTCGACGTGTACATTCCTCTCTTACCTATAATGG Downstream of PP43
P3 GGCAAGGGTTTAAAGGTGGAGATTTTTTGAGTTGCCGAATTCCATGAACGAGACTTAAAACG Upstream of PBcaprE
P4 CCTTTTAAAGTTTCGCCTCTTTCTTTTTTTCATGTCGACTCGGTTCCCTCCTCATTTTTATACCAACTTG Downstream of PBcaprE
P5 GGCAAGGGTTTAAAGGTGGAGATTTTTTGAGTGATCGTCACAATGCGCCATCAAACCG Upstream of PluxS
P6 CCTTTTAAAGTTTCGCCTCTTTCTTTTTTTCATGTCGACGGATCCCACTTTATGGACGCCGCAGTGTCTG Downstream of PluxS
P7 GGCAAGGGTTTAAAGGTGGAGATTTTTTGAGTCTATCGAGACACGTTTGGCTGG Upstream of PgsiB
P8 CCTTTTAAAGTTTCGCCTCTTTCTTTTTTTCATGTCGACTTCCTCCTTTAATTGGTGTTGGTTGTTGTATTC Downstream of PgsiB
P9 GGCAAGGGTTTAAAGGTGGAGATTTTTTGAGTGATCATTTAATTGAAGCGCGCGAAGC Upstream of PyxiE
P10 CCTTTTAAAGTTTCGCCTCTTTCTTTTTTTCATGTCGACGCTCTTCCCGCCTTTCGGACTGTGGGTGG Downstream of PyxiE
P11 GGGACAGGTAGTATTTTTTGAGAAGATCGTGTACATTCCTCTCTTACCTATAATGG Downstream for PP43-PHpaII
P12 GGCAAGGGTTTAAAGGTGGAGATTTTTTGAGTGATCTTCTCAAAAAATACTACCTGTCCC Upstream of PHpaII
P13 GGGACAGGTAGTATTTTTTGAGAAGATCTAAATCGCTCCTTTTTAGGTGGCACAAATGTG Downstream or PHpaII-PHpaII-PP43
  1. Note: Homology arms of targeting vectors for gene insertions were underlined