Skip to main content

Table 3 Six custom primers designed and used for coverage of entire fusA PCR amplicon of staphylococci for Sanger sequencing, alongside previously described forward and reverse primers (reference [34])

From: Genetic resistance determinants to fusidic acid and chlorhexidine in variably susceptible staphylococci from dogs

Primer Name Primer Sequence Forward / Reverse Base pair sequenced from
FusA_Int_A_F CGCCAACTCACGTGAAGAAA Forward 1077
FusA_Int_B_R ATTGACCACGACCACCAGAT Reverse 1516
FusA_Int_C_R TGCTTCACGTGCTTCTTCAG Reverse 639
FusA_Int_D_F CCAATCGGTGCTGAAGATGA Forward 493
FusA_Int_E_F ATCTGGTGGTCGTGGTCAAT Forward 1497
FusA_Int_F_R TGAGTTGGCTGTCATTTGTA Reverse 1086
FusA_Fa TTTACCCTGAGTGTGTTCT Forward 94
FusA_Ra TACATTTAAGCTCACCTTGT Reverse 2256
  1. aPreviously described primers (reference [34])