Skip to main content

Table 1 Primer sequences used for the amplification of secondary metabolite biosynthetic genes

From: Lipopeptide mediated biocontrol activity of endophytic Bacillus subtilis against fungal phytopathogens

Sl No Primer Sequence (5′ – 3) Annealing temperature used (°C) Approximate product Size (base pairs)
1 BaeR-F AGACTCCACCAAGGCAAATC 55 990
BaeR-R CAGCGGCTTCATGTCATACT
2 DfnD-F CAGGCGGAATAGGAGAAGTATG 54 900
DfnD-R CGGCAGCCGATTGAAATAAC
3 SrfA-F GCTGATGATGAGGAGAGCTATG 55 890
SrfA-R GATGGTCGATACGTCCGATAAA
4 MlnA-F GGCAGGGTCATACCTCATAATC 55 920
MlnA-R AGCAGACTTTCGGTCTCATTC
5 DhbE-F GCTGGAGGAAGAGTGGTATTATC 54 940
DhbE-R CAGTAAATGAAGCGGCGTTATG
6 BacD-F CCGGCGTCAAGTCTATCAAA 54 670
BacD-R CATGGCTCCTGCTCCAATAA
7 ItuA-F CGGGAAACAACAGGCAAATC 55 980
ItuA-R CGTCACCAGCGGTGTAAATA
8 FenA-F CATTCATCCTGGAGACCCTATTC 55 960
FenA-R TAAGACCGCAGGCATGTTATAG