Skip to main content

Advertisement

Table 1 Primers used for reverse transcription quantitative polymerase chain reaction (RT-qPCR)

From: Comparative gene expression analysis of planktonic Porphyromonas gingivalis ATCC 33277 in the presence of a growing biofilm versus planktonic cells

Locus name Putative identification Primers for RT-qPCR
PGN_0557 (hmuR) TonB-dependent receptor HmuR Forward Backward 5′-3′: TAGTCGCGACGGACAGAAAT 5′-3′: CTGGTGAAGATCCCACGTTT
PGN_1058 (ftn) Ferritin Forward Backward 5′-3′: GAAATGATCGAGGCTGTCGT 5′-3′: GTCCTGTGATGCCATATCTCC
PGN_0780 (prtQ) PrtQ, protease Forward Backward 5′-3′: CAGCTGTAAACCGCAACAAG 5′-3′: GGCTTGGCTCCCGTATTATC
PG_0437 Polysaccharide biosynthesis/export protein Forward Backward 5′-3′: AGAGGGCCTTACTCGTACCG 5′-3′:CCACTGGAAATAATCCTCTTCTGT
PGN_0183 (fimC) Minor component FimC Forward Backward 5′-3′:CCTTTTCAAGAAAGAACTTGAGGA 5′-3′: GTCGGACTATCGGCTCGTT
PG_2131 OmpA_c-like Forward Backward 5′-3′: ACACACCCCTCTCGTCTGAG 5′-3′: TCCCTTCCGGATAGCTCTG
PGN_0181 Fimbrillin-A associated anchor proteins Mfa1 and Mfa2 Forward Backward 5′-3′: CCACTACGGTGTCTTTCGTG 5′-3′: TTAGACGCTTTGCACATTGG
PG_1712 Alpha-1,2-mannosidase family protein Forward Backward 5′-3′: GCTACGAAAGCCGTCCATC 5′-3′: GTACCACTCCCAACCTTTGC