Skip to main content

Table 2 Primers used in this study

From: Application of qPCR assays based on haloacids transporter gene dehp2 for discrimination of Burkholderia and Paraburkholderia

Primers Sequence (5′ to 3′)a
16S-F1 GGTAATACGTAGGGTGCRAGCGTT
16S-R1 CACMAATGCAGTTCCCAGGTTRAG
16S-F2 GGAGGAATACCGATGGCGAAGG
16S-R2 TTACTAAGGAAATGAATCCCCAACAAC
16S-F3 ACAAGCGGTGGATGATGTGGAT
16S-R3 TGTGTTAYGGCTCCCTTTCGG
dehp2-F6 RCAYTCGCCGATGACGRS
dehp2-R6 GGARAAGAAGCTCTTGCTGATRT
dehp2-F7 RCMTGGGGCTGGCGCATT
dehp2-R7 GTCCGGRTTSGCGATCACGAC
  1. aDegenerated bases are shown in bold