Skip to main content

Advertisement

Table 3 Bacterial strains, plasmids, and primers used in the current study

From: Enhanced antifungal activity of bovine lactoferrin-producing probiotic Lactobacillus casei in the murine model of vulvovaginal candidiasis

Material Description Reference or source
Bacteria
L. casei Plasmid free ATCC393
E. coli DH5α Transformation host CCTCC AB 2012883
L. casei/pPG6121.-BLF Secreted BLF producer This work
L. casei/pPG6121 Transformation host This work
Plasmid
 pUC57 Ampr, ori Sangon (China)
 pPG612.1 Ampr, Cmr, ori Li et al.
 pPG612.1-BLF Ampr, Cmr, ori This work
Primers
 BamHI-F TGGATCTTGCTTTGAAGGGT This work
 BamHI-R TTTCGTCCCATAGATCTCTGC This work
 XhoI-F ACACGTGAAACAGGTGCTGCT This work
 XhoI-R TTCGTCCAACCAAACCGACT This work
  1. ATCC American Type Culture Collection, CCTCC China Center for Type Culture Collection