Skip to main content

Advertisement

Table 1 List of primers and probe for the lateral-flow strip and real-time RPA assay based on the HAdVs strain accession no. KX289874

From: Rapid detection of human mastadenovirus species B by recombinase polymerase amplification assay

Assay format Oligo name Sequence 5′-3’ Genome position
LFD-RPA ADV-RF-Bio Bio-GCTCATTGGAACAACTGCCGTAAATAGTGT 20,761–20,790
ADV-RR GGCCGAGAACGGTGTACGCAGGTAGACTGTC 21,055–21,025
ADV-RP-nfo FITC-CTCGATGACGCCGCGGTGTGGCTGGTGCAC[THF]CTGACCACGTCGAAGA-SpC3 20,979–21,025
Real-time RPA ADV-RF GCTCATTGGAACAACTGCCGTAAATAGTGT 20,761–20,790
ADV-RR GGCCGAGAACGGTGTACGCAGGTAGACTGTC 21,055–21,025
ADV-RP-exo CAGGTAGACTGTCTCGATGACGCCGCGGTGT[FAM]G[THF]CT[BHQ]GGTGCACGCTGACC-SpC3 20,989–21,037
  1. Bio Biotin, FITC fluorescein isothiocyanate, THF tetrahydrofuran, SpC3 C3 spacer, FAM 6-Carboxyfluorescein, BHQ black hole quencher