Skip to main content

Advertisement

Table 2 Primers used in this study

From: Long-term colonization exceeding six years from early infancy of Bifidobacterium longum subsp. longum in human gut

Primer Name Target Sequence (5′ - 3′) Reference
Amplification and sequencing of 16S rRNA gene for Bifidobacterium
 BI8 16S rRNA gene GGGTTYCGATTCTGGCTCAGGATG [34]
 15R   AAGGAGGTGATCCARCCGCA
 520R   ACCGCGGCTGCTGGC
Subspecies-specific PCR for Bifidobacterium longum
 BiINF-1 Bifidobacterium longum subsp. infantis TTCCAGTTGATCGCATGGTC [35]
 BiINF-2   GGAAACCCCATCTCTGGGAT
 BiLON-1 Bifidobacterium longum subsp. longum TTCCAGTTGATCGCATGGTC [35]
 BiLON-2   GGGAAGCCGTATCTCTACG
MLST for Bifidobacterium longum subsp. longum strains
 Blon-clpC-F clpC CCTGAAGAAGGTGCTGAAGG [22]
 Blon-clpC-R   TTCTCCTGCTTGTCGCGCAGT
 Blon-dnaG-F dnaG GTTGCCGTAGATTTGGGCTTGG [22]
 Blon-dnaG-R   ATGACTTCGGTGTTCCGCAC
 Blon-dnaJ-F dnaJ GCTGAGCAAGAAGGAAGATCGC [22]
 Blon-dnaJ-R   TGAACTTCTTGCCGTCCACGG
 Blon-fusA-F fusA CACCATCAAGGAGAAGCTGG [22]
 Blon-fusA-R   ACGAGCTTGCCGTAGAACG
 Blon-gyrB-if1 gyrB AAGTGCGCCGTCAGGGCTT [22]
 Blon-gyrB-R   GTGTTCGCGAAGGTGTGCAC
 Blon-purF-F2 purF CGGCTGAACTCGAAGAC This study
 Blon-purF-R2   GTTGAGCGCTTCCTTGAG
 Blon-rpoB-F rpoB AGACCGACAGCTTCGATTGG [22]
 Blon-rpoB-R   AACACGATGGCGGACTGCTT
AFLP analysis
 MseI adapter 1 Restriction site of MseI TACTCAGGACTCAT [22]
 MseI adapter 2   GACGATGAGTCCTGAG
 MspI adapter 1 Restriction site of MspI CTCGTAGACTGCGTACA [22]
 MspI adapter 2   CGTGTACGCAGTCTAC
 Preselective MseI MseI adapter GATGAGTCCTGAGTAA [22]
 Preselective MspI MspI adapter GACTGCGTACACGGA [22]
 Selective MseI-T MseI adapter GATGAGTCCTGAGTAAT [22]
 Selective MspI-A MspI adapter FAMa-GACTGCGTACACGGAA [22]
Quantification of fecal Bifidobacteirum
 g-Bifid-F Genus Bifidobacterium CTCCTGGAAACGGGTGG [17]
 g-Bifid-R   GGTGTTCTTCCCGATATCTACA
 BiADOg-1a Bifidobacterium adolescentis groupb CTCCAGTTGGATGCATGTC [17]
 BiADOg-1b   TCCAGTTGACCGCATGGT
 BiADO-2   CGAAGGCTTGCTCCCAGT
 Bflact2 Bifidobacterium animalis subsp. lactis GTGGAGACACGGTTTCCC [17]
 Bflact5   CACACCACACAATCCAATAC
 BiBIF-1 Bifidobacterium bifidum CCACATGATCGCATGTGATTG [17]
 BiBIF-2   CCGAAGGCTTGCTCCCAAA
 BiBRE-1 Bifidobacterium breve CCGGATGCTCCATCACAC [17]
 BiBRE-2   ACAAAGTGCCTTGCTCCCT
 BiCATg-1 Bifidobacterium catenulatum groupc CGGATGCTCCGACTCCT [17]
 BiCATg-2   CGAAGGCTTGCTCCCGAT
 BiDEN-1 Bifidobacterium dentium ATCCCGGGGGTTCGCCT [17]
 BiDEN-2   GAAGGGCTTGCTCCCGA
 BiINF-1 Bifidobacterium longum subsp. infantis TTCCAGTTGATCGCATGGTC [17]
 BiINF-2   GGAAACCCCATCTCTGGGAT
 BiLON-1 Bifidobacterium longum subsp. longum TTCCAGTTGATCGCATGGTC [17]
 BiLON-2   GGGAAGCCGTATCTCTACG
  1. a6-carboxyfluorescein
  2. bThe B. adolescentis group includes B. adolescentis genotypes A and B
  3. cThe B. catenulatum group includes B. catenulatum and Bifidobacteium pseudocatenulatum