Skip to main content

Table 5 Primer sequences used in this study

From: The possible molecular mechanisms of farnesol on the antifungal resistance of C. albicans biofilms: the regulation of CYR1 and PDE2

Primer name Sequence (5′ → 3′)
CYR1-F AAGACGATGAAACAGCCACA
CYR1-R AGTTGGTAAGCCAGTAGTCGG
PDE2-F ATGCTGTGGGACATTGGAGT
PDE2-R TAAAGTAGTGCCGTTGGTGC
ACT1-F GCCGGTGACGACGCTCCAAGAGCTG
ACT1-R CCGTGTTCAATTGGGTATCTCAAGGTC