Skip to main content

Table 2 A list of the molecular markers and primers used in this study

From: Nuclear and Wolbachia-based multimarker approach for the rapid and accurate identification of tsetse species

Molecular marker Marker Primer name Primer sequence 5’-3’ Reference Method of analysis
Nuclear markers ITS1 GlossinaITS1_for GTGATCCACCGCTTAGAGTGA (Dyer et al., 2008) [16] Gel electrophoresis
GlossinaITS1_rev GCAAAAGTTGACCGAACTTGA
Microsatellite markers A10 A10 F GCAACGCCAAGTGAAATAAAG
A10 R TACTGGGCTCGCGTACATAAT
Gmm14 Gmm14 F CACACCCTGGATTACAAA (Baker & Krafsur, 2001) [19]
Gmm14 R TGAAATGCAACCCTTCTT
Mitochondrial markers COI COI TTGATTTTTTGGTCATCCAGAAGT (Dyer et al., 2008) [16] Sequencing
CULR TGAAGCTTAAATTCATTGCACTAATC
16S rRNA NI-J-12585 GGTCCCTTACGAATTTGAATATATCCT
LR-N-12866 ACATGATCTGAGTTCAAACCGG
12S rRNA 12SCFR GAGAGTGACGGGCGATATGT (Doudoumis et al., 2012) [52]
12SCRR AAACCAGGATTAGATACCCTATTAT
Symbiotic markers Wolbachia 16S rRNA WspecF YATACCTATTCGAAGGGATAG Gel electrophoresis
WspecR AGCTTCGAGTGAAACCAATTC