Skip to main content

Table 1 Primers used for PCR amplification of trypanosome and bacteria DNA

From: Prevalence of symbionts and trypanosome infections in tsetse flies of two villages of the “Faro and Déo” division of the Adamawa region of Cameroon

Specificity Primer sequence (5′— 3′) Name Amplified product (bp) References
Sodalis glossinidius TGAAGTTGGGAATGTCG
AGTTGTAGCACAGCGTGTA
pSG2 120 (Darby et al., 2005) [32]
Wolbachia. sp YATACCTATTCGAAGGGATAG
AGCTTCGAGTGAAACCAATTC
16S rRNA 438 (Werren and Windsor, 2000) [34]
GTCCAATARSTGATGARGAAAC
CYGCACCAAYAGYRCTRTAAA
wsp 513 (Baldo et al., 2006) [33]
T. congolense
(savannah type)
TCGAGCGAGAACGGGCACTTTGCGA
ATTAGGGACAAACAAATCCCGCACA
TcS 341 (Moser et al., 1989) [28]
T. congolense
(forest type)
GGACACGCCAGAAGGTACTT
GTTCTCGCACCAAATCCAAC
TcF 350 (Masiga et al., 1992) [29]
T. brucei sl CGAATGAATATTAAACAATGCGCAG
AGAACCATTTATTAGCTTTGTTGC
Tbr 164 (Masiga et al., 1992) [29]
T. vivax CTGAGTGCTCCATGTGCCAC
CCACCAGAACACCAACCTGA
Tvw 150 (Masiga et al., 1992) [29]
Diag ITS1 TGGACTTCGGATTAAGTACAACA
TCATTATGCGCTATTAAGGTAAGC
Diag 150–400 (Dyer et al., 2008) [27]