Skip to main content

Table 1 Primers used for detection of selected antibiotic resistance genes

From: Identification and antibiotic susceptibility of lactobacilli isolated from turkeys

Determining resistance to Target gene Primer sequence (5’→3’) Amplicon size (bp) Annealing temperature (°C) Reference
tetracyclines tetM GTG GAC AAA GGT ACA ACG AG
CGG TAA AGT TCG TCA CAC AC
406 60 [20]
tetK GAT CAA TTG TAG CTT TAG GTG AAG G
TTT TGT TGA TTT ACC AGG TAC CAT T
155 60
tetL TGG TGG AAT GAT AGC CCA TT
CAG GAA TGA CAG CAC GCT AA
229 60
tetO AAC TTA GGC ATT CTG GCT CAC
TCC CAC TGT TCC ATA TCG TCA
515 60
tetW GAG AGC CTG CTA TAT GCC AGC
GGG CGT ATC CAC AAT GTT AAC
168 64 [50]
macrolides and lincosamides ermA CCC GAA AAA TAC GCA AAA TTT CAT
CCC TGT TTA CCC ATT TAT AAA CG
590 60 [20]
ermB TGG TAT TCC AAA TGC GTA ATG
CTG TGG TAT GGC GGG TAA GT
745 60
mefA/E CAA TAT GGG CAG GGC AAG
AAG CTG TTC CAA TGC TAC GC
317 60
ermC AAT CGT CAA TTC CTG CAT GT
TAATCGTGGAATACGGGTTTG
299 58 [35]
lnuA GGT GGC TGG GGG GTA GAT GTA TTA ACT GG
GCT TCT TTT GAA ATA CAT GGT ATT TTT CGA TC
323 61 [51]
aminoglycosides aac(6’)-Ie-aph(2”)-Ia CAG AGC CTT GGG AAG ATG AAG
CCT CGT GTA ATT CAT GTT CTG GC
348 56 [21]
aph3IIIa GGC TAA AAT GAG AAT ATC ACC GG
CTT TAA AAA ATC ATA CAG CTC GCG
523
ant(4’)-Ia CAA ACT GCT AAA TCG GTA GAA GCC
GGA AAG TTG ACC AGA CAT TAC GAA CT
294
aph(2”)-Ic CCA CAA TGA TAA TGA CTC AGT TCC C
CCA CAG CTT CCG ATA GCA AGA G
444
aph(2”)-Id GTG GTT TTT ACA GGA ATG CCA TC
CCC TCT TCA TAC CAA TCC ATA TAA CC
641
ant(6)-Ia CGG GAG AAT GGG AGA CTT TG
CTG TGG CTC CAC AAT CTG AT
563 56 [52]
aac(6’)-Ii TGGCCGGAAGAATATGGAGA
GCATTTGGTAAGACACCTACG
410 55
aadE ATG GAA TTA TTC CCA CCT GA
TCA AAA CCC CTA TTA AAG CC
1060 51 [43]
chloramphenicol cat TAA GGT TAT TGG GAT AAG TTA
GCA TGR TAA CCA TCA CAW AC
340 54 [23]
tiamulin lsaE TGT CAA ATG GTG AGC AAA CG
TGT AAA ACG GCT TCC TGA TG
496 54 [53]
penicillins blaZ ACT TCA ACA CCT GCT GCT TTC
TAG GTT CAG ATT GGC CCT TAG
240 60 [54]
mecA AGT TCT GCA GTA CCG GAT TTG C
AAA ATC GAT GGT AAA GGT TGG C
533 55 [55]
  int-Tn (Tn916/Tn1545) GCGTGATTGTATCTCACT GACGCTCCTGTTGCTTCT 1028 55 [49]