Skip to main content

Table 2 The primers used in this study

From: The alternative sigma factor RpoQ regulates colony morphology, biofilm formation and motility in the fish pathogen Aliivibrio salmonicida

Primers Sequence (5–3’) Source
RpoQ-A fwd AATAACTCGAGCAAACGAATGACATGCAGACA This study
RpoQ-B rev ATCAATGCTGTTTCTTGGTTCTTC This study
RpoQ-C fwd AGAAACAGCATTGATCTAGGCCAAGATCTTCAA This study
RpoQ-D rev TATATACTAGTCGATCTCATTATCTTCGTAATACA This study
RpoQ-G fwd AGTTCAGGTGATCGTGTTA This study
RpoQ-H rev GATTTTGCGTATTGGTAACT This study
RpoQ-E fwd CTCGAGAACAGCATTGATGCTTACTCA This study
RpoQ-F rev ACTAGTATCCACCATACCGCGTAA This study
pTM214-rpoQ fwd TCGAGCTCAGAGGAGAAATTAAGCATGTTGAATATAGAATGTTCA This study
pTM214-rpoQ rev AGGTCGACCTAATTTAAAGCATTTCTAAA This study
pNQ-fwd TAACGGCAAAAGCACCGCCGGACATCA Milton, D.
pNQ-rev TGTACACCTTAACACTCGCCTATTGTT Milton, D.