Skip to main content

Table 2 Primers used in reverse transcription PCR analysis

From: Enzymes involved in the anaerobic degradation of phenol by the sulfate-reducing bacterium Desulfatiglans anilini

PCR product Gene locus tag Primer sequence
ppsα H567DRAFT_ 02052 ppsα-1: AAGATCCTCACCAAGCACGG
ppsα-2: GGGGAACCCGGTGATTTCAT
ppsβ H567DRAFT_ 02051 ppsβ-1: TCATGTTCTCGCTCAACCCC
ppsβ-2: AGATCGATTCAGGGAACGGC
ppsγ H567DRAFT_ 03126 ppsγ-1: CGGACAGGGATCTCAAACGG
ppsγ-2: CGTTCGTAGCTGGTCAGGAT
ppcα H567DRAFT_ 03563 ppcα-1: ACCC TGTGGCAGCAGTTATC
ppcα-2: TAGAATCCCAGCTCCGACCA
ppcβ H567DRAFT_ 02059 ppcβ-1: TGACCATGGCCGTTTCCTAC
ppcβ-2: TCTTGACCATTTCGGGGTCG
ppcδ H567DRAFT_ 00862 ppcδ-1: AAGTCGTCATCATCACGGGC
ppcδ-2: AAATCGGCCATTTCACGGAC
Asrα H567DRAFT_02821 Asrα-1: ATGACCATTTCTCAGGCGCA
Asrα-2: GTCGCGCTTCATCATTTCCC