Skip to main content

Table 2 Primers used in this work

From: RpfC regulates the expression of the key regulator hrpX of the hrp/T3SS system in Xanthomonas campestris pv. campestris

Primer name Primer sequence Product length (bp)
For construction
 sacB-F CCCTCTAGA ATCAAAAAGTTTGCAAAACAAG  
 sacB-R CCCGTCGAC AAATAAAAGAAAATGCCAATAG 1419
 RpfC-1-FOR ATTGCGCTGATCCTGGTCTACAC  
 RpfC-1-REV CGGGATCC AGACTTCATAGACGCCTCAGACG 553
 RpfC-2-FOR CGGGATCC CGTAGCAACGAATAGACCGC  
 RpfC-2-REV ACAGCGACGTGTTCAATCTGGGCG 665
 PhrpG-F GGGGAGCTC GGTGTTCGGCACGCAGATGCGC  
 PhrpG-R GGGTCTAGA GTCCATCACTCGCGCGCCCACG 590
 PhrpX-F GGGGAATTC CTGACGCATAGGGCTGGTTGGGGC  
 PhrpX-R GGGGGTACC CTGGAGGTGCTGCAGACCCTGTGG 677
For sequencing
 KAN-2 FP-1 ACCTACAACAAAGCTCTCATCAACC  
 KAN-2 RP-1 GCAATGTAACATCAGAGATTTTGAG  
For qReal-time PCR
 XC0052F ACAGATTGGTCTCGCAGGTC 104
 XC0052R GGCAATGCTCTGATCGGTCT  
 XC0241F AGCCGCATCCACGAAACGGA 92
 XC0241R AACAGCGCGGTGCGTCGTAA  
 XC1553F TTTTCCGGATGGCTCGAACA 108
 XC1553R AGGATGCAGACTGACCAAGC  
 XC2004F TTGAGGCGGCCATATCACTC 119
 XC2004R CCACACTGCCGATACACCTT  
 XC2081F AGGAAGTGCGGATGAACCTG 141
 XC2081R CGCCGAAACCATTTCGAGAC  
 XC2602F TCGAGGATCCGCAAACTACG 110
 XC2602R GACCGGCATCGAGGAAAAGA  
 XC2994F CTCCTGCCATCTTGAGCGAT 122
 XC2994R CGCAATCAGCATGAAGTCCG  
 XC2995F CACGTGGGGCGAGAAAGATA 116
 XC2995R GCCGTTGGAACAAGGGAGTA  
 XC3160F GCTCGCAAGTCTGATGGAGT 126
 XC3160R CATGACGACAGACCCAGCTT  
 XC3177F ATGGACTCAGCGTTGTGGAG 110
 XC3177R TCATTGTTTCGTGGCAAGCG  
 XC3802F TTTCGACGATCTTCCCGAGC 111
 XC3802R TGGATGGAGGTGTTGTACGC  
 XC4273F CGGCGCGGAGTTAAATCTTG 129
 XC4273R AAAGTCTGCTCCGGGAATCG  
 XC3076F CGAAGTCGCATTGCTGGGCG 93
 XC3076R GCCTTGGACGCCTGCCGATA  
 XC3077F TGCGTGGCATCGGACGACAG 92
 XC3077R CACTCGAAACGGCCCAGCAC  
 XC3002F CCTGCAGACGATGGGCATCG 188
 XC3002R CGTCCTGTTGACCGCTCTGC  
 XC3003F CGTTACCTGATGACGCGCGT 155
 XC3003R AGGTCGGCGGATGCATAACC  
 XC3004F GCCTGGTGGGGCTGGTGTTCAA 164
 XC3004R CGTGCTCTGCTCACCGCTCA  
 XC3005F TGCAGCAGCTGAAGACGCGC 200
 XC3005R CAGGATCGCCTCGATGCCGA  
 XC3006F CGCCGTTTGGCGAGCTGGTGGG 179
 XC3006R CGCCTGCGCCTGGATCTGCA  
 XC3007F GCAGGCGCTGGCGGACGTCC 169
 XC3007R CACGCCGCGCTCGTTCCACG  
 XC3008F CCGTGTCCACGCTGGCGCAA 150
 XC3008R CGCCGACCTGCATGCTCGCC  
 XC3009F ACGGCCGGTGTGGATGCAGA 177
 XC3009R GGGTGTGGAGATCAGGCCGT  
 XC3010F GCTGATGCAATCCTCCTGCC 151
 XC3010R CCCCATCTTTGGCGCATTGG  
 XC3011F GCGAGTACTGCGGCCAGAGT 153
 XC3011R CAACACGCGTACAAGGCCTT  
 XC3012F TTGTGCAGACCGGGCTTAAT 160
 XC3012R TACCACAGCACCACGCCGAT  
 XC3014F GGATTGCCGGACACGGTGGT 150
 XC3014R TCGGGCGATCTGTCGACGAT  
 XC3015F TGGAACCACTGGGACTAGGCG 159
 XC3015R CAGCGCTAGCCGTTTGCAGC  
 XC3016F AATGCCATCGGCGTGCAGCA 172
 XC3016R CGCGACAGGCATCGAGCAAT  
 XC3017F GTGCGATTCACTTCCGAAGC 155
 XC3017R ACCACCACCAGCTTGAGCGC  
 XC3018F GAACTGGAAGAAGCCGAAGCG 192
 XC3018R ACGGGCGCTGTCGTCTACCT  
 XC3019F AGATTGGCCTGATTGTTCGC 178
 XC3019R CTCCAGCAGCGCAACATCGT  
 XC3020F CACGCTCACCCAGGATATGA 163
 XC3020R GACAATGAAATCGTTGCGCG  
 XC3021F GATTGGGCCAGGCCAGGGAT 168
 XC3021R CGTTCTTCTTCGCGGTCAGG  
 XC3022F CACATGCCTGCAGCCCAGAC 154
 XC3022R CCTGTGCGTACACCGACAAA  
 XC3023F CGCGCCACCCGGCCTCCAGA 185
 XC3023R CGCCGCCGCCCTTCATGTTG  
 XC3024F GTGCTGGGCCGTCACATGCT 155
 XC3024R ACCGCCTGCTGCACGACCGT  
 XC3025F GTTGCCGCCTGCGGTGGATG 188
 XC3025R GCAAGCCTTGCAGCGCACTC  
 XC1331F TGTGCCTGGATTCGGGTTGC 323
 XC1331R CCACCATCGGAAACTTGTCG  
 XC3907F CGATGTTCGCCACCCACAAC 318
 XC3907R GGATGGACGCAAACGAGGAC  
 XC3379F CAACGATGCGTCCAATGTGTC 301
 XC3379R CAAGGTTTCCACCGCTGCTG  
 XC1969F CGGCTACAAGAACGCCTACCCG 156
 XC1969R GCGATGTCCTGCTCGGAAAAGC  
 XC2272F GAGCCCTGAAATCGCCCTGACC 223
 XC2272R CTCCACCAGATGTCCCAGCAGC  
 XC3324F GTCTTCACTGCCGACGGTTC 164
 XC3324R TCGAATGCGACCTTCTCGATAC  
 XC4122F TTCGTATGATTTCCTCGGCC 142
 XC4122R TACTTGATCTTGCCTTCCTTGT  
 XC1019F ACACGATTTCTGGGTTTTGCGC 304
 XC1019R ATTCAGTGCGTTGAGTTCTGGC  
 XC3862F AGGCAAGCCCCGAATCCGAAGC 251
 XC3862R CACGGCGTCGTCCAGTGTGTTG  
 XC4147F ACGGCTACATCGGGTTGATC 197
 XC4147R TCATTTGCGGGCTTCCTCC  
 XC2979F ATGAGCGACTGGGAAGGACG 231
 XC2979R GGCAAACTGCTTGAGGTCAG  
 XC0109F GCGAAAAACGCCTGGCGGTGC 166
 XC0109R AGCTTGCCGGCATCCAGCGC  
 XC0705F CTACTGGCGTGACGTTGGTG 156
 XC0705R CACCCATCACACCGGACCTG  
 XC1002F CACTGCGTTATGTGCTGCCC 158
 XC1002R CAGTTTCGACGCGGCAATGG  
 XC1850F GGCAGCACGCGCCGCTACATCAG 151
 XC1850R TGGGCGTGGGGTTGGCATTG  
 XC2254F GAACTGGAACGTTGCCTGGG 150
 XC2254R GTGCGATGTCGCGACGAAGC  
 XC1621F GATCTGTGGAAGCAGTAACG 159
 XC1621R CTACTCGGGCCTTGAACAAC  
 XC2512F CGCGTGCGCGTAACGGTGTG 150
 XC2512R CGCTACGCGTGAAGCTGGGG  
 XC0155F GCGTGTTGCGCAGCTTCGAAC 168
 XC0155R GCATGCGCATCAGCTTGAGG  
 XC1978F CTCAAGCTGCGCGGCCATCC 151
 XC1978R GCACCATTGCGCGCCCCAGC  
 XC1294F GCGCGCAGCCAGTGCCGTGG 131
 XC1294R CGGTGCCGGCGACTGCCACT  
 XC2088F GCGAGTGGAAAAACCAGCTGGGT 140
 XC2088R AACCGGGTTGGCAAACCAGC  
 XC3540F TGAGCGTGCCAACAAGGACT 152
 XC3540R ATTCGACCTTGGTGCGCAGC  
 XC3697F GGCGACAGGCCCGCGGATGGTTGT 144
 XC3697R GCCCGCAGGCCCAGCCGAAT  
 16S-F GAGGAAGGTGGGGATGACGTCA 108
 16S-R GATTGGCTTACCCTCGCGGG